research paper introduction reddit

How to write a research paper introduction

• April 26, 2022

The introduction is the main stage when it comes to writing a research paper . Here, you set the stage for your topic and direct the reader through your exploration. This important section has several objectives:

• Engage and Intrigue: Start with your topic to spark the reader’s interest.
• Provide Context: Give a summary of existing research or background information.
• State Your Approach: Define your unique perspective clearly.
• Define the Problem: Describe the specific research problem you’re addressing.
• Map the Journey: Offer an overview of the organization of your paper.

This guide breaks down the process and shows you how to write an engaging and informative introduction, whether you’re presenting empirical information or building a persuasive argument.

First analyze a research paper introduction

Now, let’s go through an example of a research paper introduction to see a visualization of the steps before we dig deep. 

Research paper introduction example

Introduction

Step 1: Start with an engaging hook

Imagine you’re inviting a friend into a fascinating conversation. That’s exactly how your opening hook works: as an inviting gesture to read more. The hook should ignite your readers’ curiosity and make them want to know more.

Hook examples to reel you in:

• Fascinating Fact: Caffeine’s stimulating properties trace back to ancient Ethiopia.
• Thought-Provoking Question: Are you aware that each smartphone unlock reveals personal data?
• Bold Statement: In an information-saturated world, the lines between privacy and surveillance blur.

These three hooks– a fascinating fact, a thought-provoking question, and a bold statement –skillfully attract readers in a variety of ways. Their concise clarity places a stronger emphasis on relevancy than simple catchiness. They pique interest and set the stage for further exploration of the research topic.

Step 2: Establish the background

Establishing the background for your research is like building a spectacular structure from the ground up. This step varies based on your research type, but its purpose remains the same: to contextualize your work.

Background's role

Your background sets the stage for what will come, whether you are developing an argument or building on previously conducted research. Precision is the key here; provide just enough background information to help readers without overwhelming them.

Step 3: State the problem

Now, let’s learn how to clearly outline and express the problem statement in your research paper introduction. The problem statement acts as a waypoint, highlighting the issue that your research paper wants to address. It serves as the foundation and establishes the tone for your entire study.

The problem statement is your research’s compass. It outlines the main issue or challenge you’re looking into and explains why it’s interesting.

When working on the problem statement

• Be specific: Instead of saying “Environmental issues impact our world,” be more specific: “The pollution of coastal waters by industrial waste threatens marine life and human health in the Gulf region.”
• Highlight relevance: Rather than just stating “Youth unemployment is a concern,” expand: “The rising trend of youth unemployment not only hampers economic growth but also fuels social unrest and inequality in urban communities.”
• Avoid jargon: Instead of using specialized medical jargon, say: “The inadequate access to basic healthcare services in rural areas contributes to higher mortality rates and reduced quality of life.”
• Keep it concise: Rather than a long-winded description, opt for: “The lack of affordable housing options in metropolitan areas poses a pressing challenge for low-income families and individuals.”

Problem statement example

....(introduction start) ....(introduction continues) ....(introduction continues) Stress-related health issues have surged in today’s fast-paced world, necessitating alternative stress management approaches. Example problem statement ....(introduction continues)

Remember that your problem statement sets the stage for your research. You can make sure that your readers immediately understand the significance of your research with an effective problem statement.

Step 4: State the purpose and objectives

In this step, you’ll learn the value of stating your research’s purpose and objectives in your introduction. These elements serve as compass, indicating the course your research will take and helping readers comprehend your objectives.

When making clear purpose and objective statements:

• Be specific: Instead of saying “This study aims to explore various factors affecting student performance,” be more specific: “The purpose of this study is to investigate the impact of classroom environment, study habits, and parental involvement on student academic performance.”
• Align with research focus: If your research focuses on renewable energy sources, your purpose shouldn’t be about economic factors unrelated to the topic.
• Use action verbs: Instead of a vague objective like “Understand the benefits of exercise,” use an action oriented one, “Examine the impact of regular physical activity on cardiovascular health.”
• Use concise language: Instead of an overly lengthy objective, go for: “Investigate the correlation between sleep quality and academic performance among college students.”

Purpose and objectives example

....(introduction start) ....(introduction continues) ....(introduction continues) “This study examines how regular meditation reduces stress and improves overall well-being by exploring physiological and psychological mechanisms.” Purpose and objective statement ....(introduction continues)

Remember that your purpose and objectives are the foundations of your research. You lay the groundwork for a study that is focused, impactful, and easy for readers to understand by crafting clear purpose and objective statements.

Step 5: Present the thesis statement

Writing a compelling thesis statement is similar to determining your route: it informs your audience of your destination and main points.

When writing a strong thesis statement:

• Be clear: Instead of a complex statement, go for: “This study investigates the cultural influences on consumer behavior in the fashion industry.”
• Take a position Instead of a neutral statement like, “Different diets have various effects on weight loss.” , take a stance and go for “The keto diet proves to be more effective for rapid weight loss compared to low-fat diets.”
• Be specific: Instead of a broad statement like “Technology impacts education,” be more specific and focused and go for “The integration of interactive digital tools enhances student engagement and learning outcomes in K-12 classrooms.”
• Make it arguable: Instead of stating: “Climate change is a global concern,” present a debatable argument, “Human activity significantly contributes to the acceleration of climate change and demands immediate policy action.”

Thesis statement example

....(introduction starts) ....(introduction continues) ....(introduction continues) “By analyzing scientific studies, anecdotes, and expert opinions, this paper argues that regular meditation effectively reduces stress and enhances well-being.” This is a strong thesis statement as it clearly identifies the topic, outlines specific effects, presents a clear argument, and remains open for discussion and evidence presentation.

Step 6: Ensure a seamless flow of ideas

Now, let’s learn the art of logically and seamlessly transitioning from one introduction component to the next. A well-written research paper introduction should flow from one idea to the next smoothly.

Here’s how to maintain a seamless progression of ideas:

• Maintain thematic unity: Ensure each component logically relates to the next.
• Recap and preview: Summarize what you’ve discussed and offer a sneak peek of what’s to come.
• Balance detail: Instead of restating the entire historical context, refer briefly to earlier context while introducing new elements.

Make sure to use transitional phrases when changing subjects in your introduction to make it easier for readers to follow your train of thought.

Example of a good flow

With a clear roadmap set, we then transition into a comprehensive analysis of the existing literature, which highlights the various physiological and psychological mechanisms that underlie the potential positive effects of meditation on stress reduction and well-being.

Step 7: Revise and polish your introduction

In this final step, you’ll learn the importance of revising and polishing your introduction to make sure it’s perfectly tailored to academic writing . Revising is a chance to clarify your thoughts and make sure that your introduction does a good job of preparing readers for the journey ahead.

Guidelines for improving the introduction

• Language and clarity: Instead of complex language, choose simpler phrasing: “The purpose of this study is to explore…” instead of “This study’s intention is to investigate…”
• Conciseness: Trim any excess without losing vital information. Condense wordy phrases like “It is important to note that…” to “Note that…”
• Vivid language: Employ descriptive language that vividly paints your concepts. Instead of saying “The results were good,” say “The findings revealed promising outcomes.”
• Active voice: Favor active voice over passive constructions for direct and engaging sentences. Change; “The data was analyzed by the researcher” to “The researcher analyzed the data.

You elevate your introduction to a higher standard by carefully revising it and embracing feedback. A well-written introduction not only holds the attention of your readers but also sets the tone for an outstanding paper.

The key to capturing readers’ attention and laying the groundwork for your study is to create a captivating research paper introduction. You’re well on your way to writing introductions that fascinate your readers by following the step-by-step instructions presented in this article.

The journey does not, however, end here. In the following article in our learning series, we discuss how to write effective paragraphs . Join us there to take the next step in your research paper writing journey.

Frequently Asked Questions

What should be included in the introduction of a research paper.

A research paper’s introduction should contain important details that establish the context for your study. Start with a hook to draw readers in, give background information to set the stage, describe the problem or research question, note any research gaps, list the purpose and objectives, and finish with a clear thesis statement that summarizes your paper’s main argument.

How can I make my introduction more engaging?

Consider opening with an interesting anecdote, a surprising fact, or a thought-provoking question to make your introduction engaging. These hooks can draw readers in and encourage them to continue reading. Additionally, utilize vivid language, relatable examples, and realistic scenarios to engage your readers and pique their curiosity.

Is it necessary to write the introduction before completing the rest of the paper?

Even though it’s common to draft your introduction early in the writing process, you could find it helpful to go back and improve it once you write the remainder of the paper. As your study evolves, your understanding of its context, problem, and significance may deepen. As a result, editing the introduction after the paper is finished can help to make sure that it accurately conveys the subject and purpose of your research paper.

Recently on Tamara Blog

How to write a discussion essay (with steps & examples), writing a great poetry essay (steps & examples), how to write a process essay (steps & examples), writing a common app essay (steps & examples), how to write a synthesis essay (steps & examples), how to write a horror story.

• Translators
• Graphic Designers

Please enter the email address you used for your account. Your sign in information will be sent to your email address after it has been verified.

How to Write an Effective Research Paper Introduction

The introduction of a research paper has several purposes. It presents your topic, describes the problem your research seeks to solve, and outlines the structure of your paper. It can also inform your audience about how your study differs from the research that has already been done. Generally, the introduction helps you to show your audience why your research topic is worth exploring. It gives you the chance to convince your reader why they should stick around and see what you have to say.

The first 1-2 sentences of your introduction should give an elevator pitch of your work. Be clear, relevant, and to the point. Don't sweat the engagement of your first sentences. You might have heard the advice that, when writing, you should use the first few sentences to wow your readers, transporting them into a lyrical world of imagination. While this is certainly good counsel in creative writing or consumer literature to hook your reader, research papers are another story; you won't need quotes from wise heroes of the past to grab your readers' attention. In most cases, your audience comprises people already interested in the field who are intrigued by your title and want to delve into what you have found through your study, and you don't want to include trite snippets right at the outset. Of course, you don't want to bore your readers either, so strive for clarity and direct information about your study so the readers who navigate to your paper know what they can expect.

To introduce your research paper effectively, include the following elements in your introduction. You will expand on these topics in greater detail in the paper, but in the introduction to your paper, you'll provide a summary of each one.

• Overview: Provide a focused statement on the subject matter of your research. What questions are you seeking to answer? How will your study make the world a better place? Here you can also briefly describe any problems you encountered while conducting your study (and be sure to state that you will address these problems within the paper!).
• Prior research: It's important that your audience knows you've already explored the field and looked around at what has already been written. Briefly discuss what past studies have concluded on the subject and what that means for your current study. Maybe in your search, you found that your research is the first to address your specific topic, which is why your study is so valuable. Let your readers know that you've done your homework.
• Rationale: Make your case regarding why your study is important today. What will your findings bring to the field? Your research could address current issues and events, or it might illuminate gaps in previous research that need to be filled in order to move ahead in the academic field and strengthen future studies.
• Methodology: In your methodology paragraph, briefly name the processes you applied during your study. Why are these tools the best ones for your specific research? What answers do you get from using these methods? Details on your methodology can bring credibility to your study and help with future application of your findings to similar fields.

• Outline of the paper: At the conclusion on your introduction, offer a review of what your study will discuss specifically in the sections that follow.

Once you've gathered all of the necessary elements for your introduction, try these tips to make your introduction pop:

• Try finalizing your introduction after you've finished writing the body of the paper. While it's beneficial to map out what you want your introduction to say before you begin your paper, wait until you've elaborated on your research in detail, and then create your introduction. With the entire work fresh in your mind, you have a clear grasp on what it's about, your purpose in writing it, and what the study results mean for the world.
• Show, don't tell. When giving a brief summary of your work, give compelling details about why this study is a good one to conduct. Remember, you still want to be brief, but you can accomplish clarity and brevity while also enticing your readers to share your vision. For example, instead of stating, "Dual language educational programs are important for children," consider saying, "Dual language programs help students develop increased cognitive function, future linguistic advantages, and a broadened worldview."
• Keep it simple. Don't bury the good points of your work in excessive detail within the introduction. Your entire paper is where you will delve into the finer points of the research, so take stock of which ideas are the most important and stick to those nuggets to motivate your audience to read on.
• Speak to a broader audience. Your research will certainly attract specialists in the field who know every term you could possibly throw at them, but your audience also includes laymen and people who haven't spent as much time in the field as you have, knee-deep in your study. Remember to make your introduction accessible to those who aren't familiar with the industry jargon. The body of the paper is a great place to flex your muscles and the nitty-gritty details of your research results, but the introduction should be consumable by a much more general group. If you have to use specialized language, make sure to define those obscure terms that only a select few people would know.

Your introduction gives your readers greater access to your work. You are the expert, of course, but your goal is to display your findings to a broader audience, and your introduction is the key to accomplishing that objective. Follow these tips and examples to help you create a strong introductory section for your research paper.

• Privacy Policy

Home » Research Paper – Structure, Examples and Writing Guide

Research Paper – Structure, Examples and Writing Guide

Table of Contents

Research Paper

Definition:

Research Paper is a written document that presents the author’s original research, analysis, and interpretation of a specific topic or issue.

It is typically based on Empirical Evidence, and may involve qualitative or quantitative research methods, or a combination of both. The purpose of a research paper is to contribute new knowledge or insights to a particular field of study, and to demonstrate the author’s understanding of the existing literature and theories related to the topic.

Structure of Research Paper

The structure of a research paper typically follows a standard format, consisting of several sections that convey specific information about the research study. The following is a detailed explanation of the structure of a research paper:

The title page contains the title of the paper, the name(s) of the author(s), and the affiliation(s) of the author(s). It also includes the date of submission and possibly, the name of the journal or conference where the paper is to be published.

The abstract is a brief summary of the research paper, typically ranging from 100 to 250 words. It should include the research question, the methods used, the key findings, and the implications of the results. The abstract should be written in a concise and clear manner to allow readers to quickly grasp the essence of the research.

Introduction

The introduction section of a research paper provides background information about the research problem, the research question, and the research objectives. It also outlines the significance of the research, the research gap that it aims to fill, and the approach taken to address the research question. Finally, the introduction section ends with a clear statement of the research hypothesis or research question.

Literature Review

The literature review section of a research paper provides an overview of the existing literature on the topic of study. It includes a critical analysis and synthesis of the literature, highlighting the key concepts, themes, and debates. The literature review should also demonstrate the research gap and how the current study seeks to address it.

The methods section of a research paper describes the research design, the sample selection, the data collection and analysis procedures, and the statistical methods used to analyze the data. This section should provide sufficient detail for other researchers to replicate the study.

The results section presents the findings of the research, using tables, graphs, and figures to illustrate the data. The findings should be presented in a clear and concise manner, with reference to the research question and hypothesis.

The discussion section of a research paper interprets the findings and discusses their implications for the research question, the literature review, and the field of study. It should also address the limitations of the study and suggest future research directions.

The conclusion section summarizes the main findings of the study, restates the research question and hypothesis, and provides a final reflection on the significance of the research.

The references section provides a list of all the sources cited in the paper, following a specific citation style such as APA, MLA or Chicago.

How to Write Research Paper

You can write Research Paper by the following guide:

• Choose a Topic: The first step is to select a topic that interests you and is relevant to your field of study. Brainstorm ideas and narrow down to a research question that is specific and researchable.
• Conduct a Literature Review: The literature review helps you identify the gap in the existing research and provides a basis for your research question. It also helps you to develop a theoretical framework and research hypothesis.
• Develop a Thesis Statement : The thesis statement is the main argument of your research paper. It should be clear, concise and specific to your research question.
• Plan your Research: Develop a research plan that outlines the methods, data sources, and data analysis procedures. This will help you to collect and analyze data effectively.
• Collect and Analyze Data: Collect data using various methods such as surveys, interviews, observations, or experiments. Analyze data using statistical tools or other qualitative methods.
• Organize your Paper : Organize your paper into sections such as Introduction, Literature Review, Methods, Results, Discussion, and Conclusion. Ensure that each section is coherent and follows a logical flow.
• Write your Paper : Start by writing the introduction, followed by the literature review, methods, results, discussion, and conclusion. Ensure that your writing is clear, concise, and follows the required formatting and citation styles.
• Edit and Proofread your Paper: Review your paper for grammar and spelling errors, and ensure that it is well-structured and easy to read. Ask someone else to review your paper to get feedback and suggestions for improvement.
• Cite your Sources: Ensure that you properly cite all sources used in your research paper. This is essential for giving credit to the original authors and avoiding plagiarism.

Research Paper Example

Note : The below example research paper is for illustrative purposes only and is not an actual research paper. Actual research papers may have different structures, contents, and formats depending on the field of study, research question, data collection and analysis methods, and other factors. Students should always consult with their professors or supervisors for specific guidelines and expectations for their research papers.

Research Paper Example sample for Students:

Title: The Impact of Social Media on Mental Health among Young Adults

Abstract: This study aims to investigate the impact of social media use on the mental health of young adults. A literature review was conducted to examine the existing research on the topic. A survey was then administered to 200 university students to collect data on their social media use, mental health status, and perceived impact of social media on their mental health. The results showed that social media use is positively associated with depression, anxiety, and stress. The study also found that social comparison, cyberbullying, and FOMO (Fear of Missing Out) are significant predictors of mental health problems among young adults.

Introduction: Social media has become an integral part of modern life, particularly among young adults. While social media has many benefits, including increased communication and social connectivity, it has also been associated with negative outcomes, such as addiction, cyberbullying, and mental health problems. This study aims to investigate the impact of social media use on the mental health of young adults.

Literature Review: The literature review highlights the existing research on the impact of social media use on mental health. The review shows that social media use is associated with depression, anxiety, stress, and other mental health problems. The review also identifies the factors that contribute to the negative impact of social media, including social comparison, cyberbullying, and FOMO.

Methods : A survey was administered to 200 university students to collect data on their social media use, mental health status, and perceived impact of social media on their mental health. The survey included questions on social media use, mental health status (measured using the DASS-21), and perceived impact of social media on their mental health. Data were analyzed using descriptive statistics and regression analysis.

Results : The results showed that social media use is positively associated with depression, anxiety, and stress. The study also found that social comparison, cyberbullying, and FOMO are significant predictors of mental health problems among young adults.

Discussion : The study’s findings suggest that social media use has a negative impact on the mental health of young adults. The study highlights the need for interventions that address the factors contributing to the negative impact of social media, such as social comparison, cyberbullying, and FOMO.

Conclusion : In conclusion, social media use has a significant impact on the mental health of young adults. The study’s findings underscore the need for interventions that promote healthy social media use and address the negative outcomes associated with social media use. Future research can explore the effectiveness of interventions aimed at reducing the negative impact of social media on mental health. Additionally, longitudinal studies can investigate the long-term effects of social media use on mental health.

Limitations : The study has some limitations, including the use of self-report measures and a cross-sectional design. The use of self-report measures may result in biased responses, and a cross-sectional design limits the ability to establish causality.

Implications: The study’s findings have implications for mental health professionals, educators, and policymakers. Mental health professionals can use the findings to develop interventions that address the negative impact of social media use on mental health. Educators can incorporate social media literacy into their curriculum to promote healthy social media use among young adults. Policymakers can use the findings to develop policies that protect young adults from the negative outcomes associated with social media use.

References :

• Twenge, J. M., & Campbell, W. K. (2019). Associations between screen time and lower psychological well-being among children and adolescents: Evidence from a population-based study. Preventive medicine reports, 15, 100918.
• Primack, B. A., Shensa, A., Escobar-Viera, C. G., Barrett, E. L., Sidani, J. E., Colditz, J. B., … & James, A. E. (2017). Use of multiple social media platforms and symptoms of depression and anxiety: A nationally-representative study among US young adults. Computers in Human Behavior, 69, 1-9.
• Van der Meer, T. G., & Verhoeven, J. W. (2017). Social media and its impact on academic performance of students. Journal of Information Technology Education: Research, 16, 383-398.

Appendix : The survey used in this study is provided below.

Social Media and Mental Health Survey

• How often do you use social media per day?
• Less than 30 minutes
• 30 minutes to 1 hour
• 1 to 2 hours
• 2 to 4 hours
• More than 4 hours
• Which social media platforms do you use?
• Others (Please specify)
• How often do you experience the following on social media?
• Social comparison (comparing yourself to others)
• Cyberbullying
• Fear of Missing Out (FOMO)
• Have you ever experienced any of the following mental health problems in the past month?
• Do you think social media use has a positive or negative impact on your mental health?
• Very positive
• Somewhat positive
• Somewhat negative
• Very negative
• In your opinion, which factors contribute to the negative impact of social media on mental health?
• Social comparison
• In your opinion, what interventions could be effective in reducing the negative impact of social media on mental health?
• Education on healthy social media use
• Counseling for mental health problems caused by social media
• Social media detox programs
• Regulation of social media use

Thank you for your participation!

Applications of Research Paper

Research papers have several applications in various fields, including:

• Advancing knowledge: Research papers contribute to the advancement of knowledge by generating new insights, theories, and findings that can inform future research and practice. They help to answer important questions, clarify existing knowledge, and identify areas that require further investigation.
• Informing policy: Research papers can inform policy decisions by providing evidence-based recommendations for policymakers. They can help to identify gaps in current policies, evaluate the effectiveness of interventions, and inform the development of new policies and regulations.
• Improving practice: Research papers can improve practice by providing evidence-based guidance for professionals in various fields, including medicine, education, business, and psychology. They can inform the development of best practices, guidelines, and standards of care that can improve outcomes for individuals and organizations.
• Educating students : Research papers are often used as teaching tools in universities and colleges to educate students about research methods, data analysis, and academic writing. They help students to develop critical thinking skills, research skills, and communication skills that are essential for success in many careers.
• Fostering collaboration: Research papers can foster collaboration among researchers, practitioners, and policymakers by providing a platform for sharing knowledge and ideas. They can facilitate interdisciplinary collaborations and partnerships that can lead to innovative solutions to complex problems.

When to Write Research Paper

Research papers are typically written when a person has completed a research project or when they have conducted a study and have obtained data or findings that they want to share with the academic or professional community. Research papers are usually written in academic settings, such as universities, but they can also be written in professional settings, such as research organizations, government agencies, or private companies.

Here are some common situations where a person might need to write a research paper:

• For academic purposes: Students in universities and colleges are often required to write research papers as part of their coursework, particularly in the social sciences, natural sciences, and humanities. Writing research papers helps students to develop research skills, critical thinking skills, and academic writing skills.
• For publication: Researchers often write research papers to publish their findings in academic journals or to present their work at academic conferences. Publishing research papers is an important way to disseminate research findings to the academic community and to establish oneself as an expert in a particular field.
• To inform policy or practice : Researchers may write research papers to inform policy decisions or to improve practice in various fields. Research findings can be used to inform the development of policies, guidelines, and best practices that can improve outcomes for individuals and organizations.
• To share new insights or ideas: Researchers may write research papers to share new insights or ideas with the academic or professional community. They may present new theories, propose new research methods, or challenge existing paradigms in their field.

Purpose of Research Paper

The purpose of a research paper is to present the results of a study or investigation in a clear, concise, and structured manner. Research papers are written to communicate new knowledge, ideas, or findings to a specific audience, such as researchers, scholars, practitioners, or policymakers. The primary purposes of a research paper are:

• To contribute to the body of knowledge : Research papers aim to add new knowledge or insights to a particular field or discipline. They do this by reporting the results of empirical studies, reviewing and synthesizing existing literature, proposing new theories, or providing new perspectives on a topic.
• To inform or persuade: Research papers are written to inform or persuade the reader about a particular issue, topic, or phenomenon. They present evidence and arguments to support their claims and seek to persuade the reader of the validity of their findings or recommendations.
• To advance the field: Research papers seek to advance the field or discipline by identifying gaps in knowledge, proposing new research questions or approaches, or challenging existing assumptions or paradigms. They aim to contribute to ongoing debates and discussions within a field and to stimulate further research and inquiry.
• To demonstrate research skills: Research papers demonstrate the author’s research skills, including their ability to design and conduct a study, collect and analyze data, and interpret and communicate findings. They also demonstrate the author’s ability to critically evaluate existing literature, synthesize information from multiple sources, and write in a clear and structured manner.

Characteristics of Research Paper

Research papers have several characteristics that distinguish them from other forms of academic or professional writing. Here are some common characteristics of research papers:

• Evidence-based: Research papers are based on empirical evidence, which is collected through rigorous research methods such as experiments, surveys, observations, or interviews. They rely on objective data and facts to support their claims and conclusions.
• Structured and organized: Research papers have a clear and logical structure, with sections such as introduction, literature review, methods, results, discussion, and conclusion. They are organized in a way that helps the reader to follow the argument and understand the findings.
• Formal and objective: Research papers are written in a formal and objective tone, with an emphasis on clarity, precision, and accuracy. They avoid subjective language or personal opinions and instead rely on objective data and analysis to support their arguments.
• Citations and references: Research papers include citations and references to acknowledge the sources of information and ideas used in the paper. They use a specific citation style, such as APA, MLA, or Chicago, to ensure consistency and accuracy.
• Peer-reviewed: Research papers are often peer-reviewed, which means they are evaluated by other experts in the field before they are published. Peer-review ensures that the research is of high quality, meets ethical standards, and contributes to the advancement of knowledge in the field.
• Objective and unbiased: Research papers strive to be objective and unbiased in their presentation of the findings. They avoid personal biases or preconceptions and instead rely on the data and analysis to draw conclusions.

Advantages of Research Paper

Research papers have many advantages, both for the individual researcher and for the broader academic and professional community. Here are some advantages of research papers:

• Contribution to knowledge: Research papers contribute to the body of knowledge in a particular field or discipline. They add new information, insights, and perspectives to existing literature and help advance the understanding of a particular phenomenon or issue.
• Opportunity for intellectual growth: Research papers provide an opportunity for intellectual growth for the researcher. They require critical thinking, problem-solving, and creativity, which can help develop the researcher’s skills and knowledge.
• Career advancement: Research papers can help advance the researcher’s career by demonstrating their expertise and contributions to the field. They can also lead to new research opportunities, collaborations, and funding.
• Academic recognition: Research papers can lead to academic recognition in the form of awards, grants, or invitations to speak at conferences or events. They can also contribute to the researcher’s reputation and standing in the field.
• Impact on policy and practice: Research papers can have a significant impact on policy and practice. They can inform policy decisions, guide practice, and lead to changes in laws, regulations, or procedures.
• Advancement of society: Research papers can contribute to the advancement of society by addressing important issues, identifying solutions to problems, and promoting social justice and equality.

Limitations of Research Paper

Research papers also have some limitations that should be considered when interpreting their findings or implications. Here are some common limitations of research papers:

• Limited generalizability: Research findings may not be generalizable to other populations, settings, or contexts. Studies often use specific samples or conditions that may not reflect the broader population or real-world situations.
• Potential for bias : Research papers may be biased due to factors such as sample selection, measurement errors, or researcher biases. It is important to evaluate the quality of the research design and methods used to ensure that the findings are valid and reliable.
• Ethical concerns: Research papers may raise ethical concerns, such as the use of vulnerable populations or invasive procedures. Researchers must adhere to ethical guidelines and obtain informed consent from participants to ensure that the research is conducted in a responsible and respectful manner.
• Limitations of methodology: Research papers may be limited by the methodology used to collect and analyze data. For example, certain research methods may not capture the complexity or nuance of a particular phenomenon, or may not be appropriate for certain research questions.
• Publication bias: Research papers may be subject to publication bias, where positive or significant findings are more likely to be published than negative or non-significant findings. This can skew the overall findings of a particular area of research.
• Time and resource constraints: Research papers may be limited by time and resource constraints, which can affect the quality and scope of the research. Researchers may not have access to certain data or resources, or may be unable to conduct long-term studies due to practical limitations.

About the author

Muhammad Hassan

Researcher, Academic Writer, Web developer

You may also like

Research Questions – Types, Examples and Writing...

APA Table of Contents – Format and Example

Research Summary – Structure, Examples and...

Background of The Study – Examples and Writing...

Research Problem – Examples, Types and Guide

Purpose of Research – Objectives and Applications

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

• View all journals
• Explore content
• About the journal
• Publish with us
• Sign up for alerts
• 30 August 2024

Researchers built an ‘AI Scientist’ — what can it do?

• Davide Castelvecchi

You can also search for this author in PubMed   Google Scholar

Credit: Moor Studio/Getty

Could science be fully automated? A team of machine-learning researchers has now tried.

‘AI Scientist’, created by a team at Tokyo company Sakana AI and at academic labs in Canada and the United Kingdom, performs the full cycle of research from reading the existing literature on a problem and formulating hypothesis for new developments to trying out solutions and writing a paper. AI Scientist even does some of the job of peer reviewers and evaluates its own results.

AI Scientist joins a slew of efforts to create AI agents that have automated at least parts of the scientific process. “To my knowledge, no one has yet done the total scientific community, all in one system,” says AI Scientist co-creator Cong Lu, a machine-learning researcher at the University of British Columbia in Vancouver, Canada. The results 1 were posted on the arXiv preprint server this month.

“It’s impressive that they’ve done this end-to-end,” says Jevin West, a computational social scientist at the University of Washington in Seattle. “And I think we should be playing around with these ideas, because there could be potential for helping science.”

The output is not earth-shattering so far, and the system can only do research in the field of machine learning itself. In particular, AI Scientist is lacking what most scientists would consider the crucial part of doing science — the ability to do laboratory work . “There’s still a lot of work to go from AI that makes a hypothesis to implementing that in a robot scientist,” says Gerbrand Ceder, a materials scientist at Lawrence Berkeley National Laboratory and the University of California, Berkeley. Still, Ceder adds, “If you look into the future, I have zero doubt in mind that this is where much of science will go.”

Automated experiments

AI Scientist is based on a large language model (LLM). Using a paper that describes a machine learning algorithm as template, it starts from searching the literature for similar work. The team then employed the technique called evolutionary computation, which is inspired by the mutations and natural selection of Darwinian evolution. It proceeds in steps, applying small, random changes to an algorithm and selecting the ones that provide an improvement in efficiency.

To do so, AI Scientist conducts its own ‘experiments’ by running the algorithms and measuring how they perform. At the end, it produces a paper, and evaluates it in a sort of automated peer review. After ‘augmenting the literature’ this way, the algorithm can then start the cycle again, building on its own results.

The authors admit that the papers AI Scientists produced contained only incremental developments. Some other researchers were scathing in their comments on social media. “As an editor of a journal, I would likely desk-reject them. As a reviewer, I would reject them,” said one commenter on the website Hacker News.

West also says that the authors took a reductive view of how researchers learn about the current state of their field. A lot of what they know comes from other forms of communication, such as going to conferences or chatting to colleagues at the water cooler. “Science is more than a pile of papers,” says West. “You can have a 5-minute conversation that will be better than a 5-hour study of the literature.”

West’s colleague Shahan Memon agrees — but both West and Memon praise the authors for having made their code and results fully open. This has enabled them to analyze the AI Scientist’s results. They’ve found, for example, that it has a “popularity bias” in the choice of earlier papers it lists as references, skirting towards those with high citation counts. Memon and West say they are also looking into measuring whether AI Scientist’s choices were the most relevant ones.

Repetitive tasks

AI Scientist is, of course, not the first attempt at automating at least various parts of the job of a researcher: the dream of automating scientific discovery is as old as artificial intelligence itself — dating back to the 1950s, says Tom Hope, a computer scientist at the Allen Institute for AI based in Jerusalem. Already a decade ago, for example, the Automatic Statistician 2 was able to analyse sets of data and write up its own papers. And Ceder and his colleagues have even automated some bench work: the ‘ robot chemist ’ they unveiled last year can synthesize new materials and experiment with them 3 .

Hope says that current LLMs “are not able to formulate novel and useful scientific directions beyond basic superficial combinations of buzzwords”. Still, Ceder says that even if AI won’t able to do the more creative part of the work any time soon, it could still automate a lot of the more repetitive aspects of research. “At the low level, you’re trying to analyse what something is, how something responds. That’s not the creative part of science, but it’s 90% of what we do.” Lu says he got a similar feedback from a lot of other researchers, too. “People will say, I have 100 ideas that I don’t have time for. Get the AI Scientist to do those.”

Lu says that to broaden AI Scientist’s capabilities — even to abstract fields beyond machine learning, such as pure mathematics — it might need to include other techniques beyond language models. Recent results on solving maths problems by Google Deep Mind, for example, have shown the power of combining LLMs with techniques of ‘symbolic’ AI, which build logical rules into a system rather than merely relying on it learning from statistical patterns in data. But the current iteration is but a start, he says. “We really believe this is the GPT-1 of AI science,” he says, referring to an early large language model by OpenAI in San Francisco, California.

The results feed into a debate that is at the top of many researchers’ concerns these days, says West. “All my colleagues in different sciences are trying to figure out, where does AI fit in in what we do? It does force us to think what is science in the twenty-first century — what it could be, what it is, what it is not,” he says.

doi: https://doi.org/10.1038/d41586-024-02842-3

Lu, C., Lu, C., Lange, R. T., Foerster, J., Clune, J. & Ha, D. Preprint at arXiv https://arxiv.org/abs/2408.06292 (2024).

Ghahramani, Z. Nature 521 , 452–459 (2015).

Google Scholar  

Szymanski, N. J. et al. Nature 624 , 86–91 (2023).

Download references

Reprints and permissions

Related Articles

AI Copernicus ‘discovers’ that Earth orbits the Sun

‘Set it and forget it’: automated lab uses AI and robotics to improve proteins

• Machine learning

LLMs produce racist output when prompted in African American English

News & Views 28 AUG 24

Urgently clarify how AI can be used in medicine under new EU law

Correspondence 27 AUG 24

AI firms must play fair when they use academic data in training

Editorial 27 AUG 24

Division Director - Experimental Hematology and Cancer Biology

Cincinnati Children’s Hospital seeks the next Director for the Division of Experimental Hematology and Cancer Biology.

Cincinnati, Ohio

Cincinnati Children's Hospital & Medical Center

Faculty and Research Positions, Postdoctoral Recruitment

Jointly sponsored by the Hangzhou Municipal People's Government and the University of Chinese Academy of Sciences.

Hangzhou, Zhejiang, China

Hangzhou Institute of Advanced Study, UCAS

Associate or Senior Editor, Nature Energy

Job Title: Associate or Senior Editor, Nature Energy Location: New York, Jersey City, Philadelphia or London — Hybrid Working Application Deadline:...

New York City, New York (US)

Springer Nature Ltd

Faculty Positions & Postdocs at Institute of Physics (IOP), Chinese Academy of Sciences

IOP is the leading research institute in China in condensed matter physics and related fields. Through the steadfast efforts of generations of scie...

Beijing, China

Institute of Physics (IOP), Chinese Academy of Sciences (CAS)

FACULTY POSITION IN THE MOLECULAR BIOLOGY OF REPRODUCTION

Dallas, Texas (US)

The University of Texas Southwestern Medical Center (UT Southwestern Medical Center)

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Quick links

• Explore articles by subject
• Guide to authors
• Editorial policies

• Search Menu
• Sign in through your institution
• Chemical Biology and Nucleic Acid Chemistry
• Computational Biology
• Critical Reviews and Perspectives
• Data Resources and Analyses
• Gene Regulation, Chromatin and Epigenetics
• Genome Integrity, Repair and Replication
• Nucleic Acid Enzymes
• RNA and RNA-protein complexes
• Synthetic Biology and Bioengineering
• Molecular and Structural Biology
• Advance Articles
• Breakthrough Articles
• Molecular Biology Database Collection
• Special Collections
• Scope and Criteria for Consideration
• Author Guidelines
• Data Deposition Policy
• Database Issue Guidelines
• Web Server Issue Guidelines
• Submission Site
• About Nucleic Acids Research
• Editors & Editorial Board
• Information of Referees
• Self-Archiving Policy
• Dispatch Dates
• Advertising and Corporate Services
• Journals Career Network
• Journals on Oxford Academic
• Books on Oxford Academic

Article Contents

Introduction, materials and methods, data availability, supplementary data, acknowledgements.

• < Previous

DdrC, a unique DNA repair factor from D. radiodurans , senses and stabilizes DNA breaks through a novel lesion-recognition mechanism

• Article contents
• Figures & tables
• Supplementary Data

Robert Szabla, Mingyi Li, Victoria Warner, Yifeng Song, Murray Junop, DdrC, a unique DNA repair factor from D. radiodurans , senses and stabilizes DNA breaks through a novel lesion-recognition mechanism, Nucleic Acids Research , Volume 52, Issue 15, 27 August 2024, Pages 9282–9302, https://doi.org/10.1093/nar/gkae635

• Permissions Icon Permissions

The bacterium Deinococcus radiodurans is known to survive high doses of DNA damaging agents. This resistance is the result of robust antioxidant systems which protect efficient DNA repair mechanisms that are unique to Deinococcus species. The protein DdrC has been identified as an important component of this repair machinery. DdrC is known to bind to DNA in vitro and has been shown to circularize and compact DNA fragments. The mechanism and biological relevance of this activity is poorly understood. Here, we show that the DdrC homodimer is a lesion-sensing protein that binds to two single-strand (ss) or double-strand (ds) breaks. The immobilization of DNA breaks in pairs consequently leads to the circularization of linear DNA and the compaction of nicked DNA. The degree of compaction is directly proportional with the number of available nicks. Previously, the structure of the DdrC homodimer was solved in an unusual asymmetric conformation. Here, we solve the structure of DdrC under different crystallographic environments and confirm that the asymmetry is an endogenous feature of DdrC. We propose a dynamic structural mechanism where the asymmetry is necessary to trap a pair of lesions. We support this model with mutant disruption and computational modeling experiments.

The bacterium Deinococcus radiodurans , along with other species of the Deinococcus genus, are distinguished for their ability to survive high doses of DNA-damaging agents, such as UV-C radiation, ionizing radiation, and desiccation ( 1 , 2 ). Several factors have been proposed to contribute to the DNA-damage resistance phenotype. Most notably is the atypically high intracellular concentration of Mn 2+ -based antioxidant species, which protects the proteome from oxidative damage both enzymatically and non-enzymatically ( 3–5 ). Shielding of the proteome enables D. radiodurans to respond rapidly to DNA damage via extremely efficient DNA repair mechanisms ( 6 , 7 ).

The response mechanism begins with the activation of the Radiation-Desiccation Response (RDR) when the bacterium senses conditions that can lead to DNA damage ( 8 , 9 ). The RDR cascade triggers the upregulation of several proteins with established connections to DNA repair including RecA, UvrA/B, GyrA/B and SSB. Among the most highly upregulated genes are five Deinococcus-unique genes: ddrA, ddrB, ddrC, ddrD and pprA (ddr, DNA-damage response; ppr, pleiotropic protein promoting DNA repair) ( 10–14 ). With the exception of DdrA, these genes do not have any identifiable sequence homologs in species outside of the Deinococcus genus. This lack of homology prompted investigations into the function of each of these upregulated genes, as they may be Deinococcus -specific DNA repair factors. Interestingly, the protein products of all five genes have been found to interact directly with DNA and effect a variety of functions related to genome maintenance. PprA is a regulator of DNA Gyrase activity, ensuring the proper resolution of various DNA topologies that arise during DNA repair ( 15–17 ). DdrA is a distant homolog of eukaryotic Rad52 ( 18–20 ). DdrB binds to single-stranded (ss) DNA and promotes accurate single-strand annealing ( 21–23 ). DdrD also binds to ss-DNA, but its function is largely unknown ( 24 ).

Multiple DNA-related behaviors have been documented for DdrC. The protein has been observed to bind to both ss- and ds-DNA ( 25 ). When bound to ss-DNA, DdrC can promote the annealing of complimentary DNA strands. When bound to ds-DNA, DdrC has been observed to circularize linear DNA, and to condense plasmids into compact shapes. Currently, it is unclear how DdrC accomplishes these various functions, nor which of these functions are biologically relevant.

In this study, we show that DdrC compacts circular dsDNA through specific interactions with ss-breaks. We demonstrate that each DdrC dimer binds to and immobilizes two ss-breaks relative to one another. DNA compaction then emerges as a consequence of trapping pairs of lesions along a DNA fragment. We also show that DdrC recognizes and immobilizes pairs of ds-breaks through an analogous break-trapping mechanism, the consequence of which is the circularization of linear DNA.

During the preparation of this manuscript, a crystal structure of DdrC was published, revealing that DdrC exists as a homodimer ( 26 ). Curiously, the structure of the DdrC homodimer is in an asymmetric conformation, where one DdrC monomer is in a different conformation from the other. This is highly unusual, as homo-oligomers of proteins typically assemble into symmetric assemblies. From the DdrC crystal structure alone, it is unclear whether the dimer asymmetry is an evolved feature or if it is a crystallographic artifact. In this study, we solved the structure of the DdrC dimer under different crystallographic environments and still observed the same asymmetric structure, indicating that dimer asymmetry is in fact an endogenous feature of DdrC.

We propose a structural mechanism where the DdrC dimer scans for and identifies DNA lesions through mechanical deformations of the DNA. In this model, the asymmetry of DdrC is an essential part of the lesion scanning process.

Recombinant protein expression and purification

The ORF sequence of ddrC from D. radiodurans (Uniprot #Q9RYE6) was codon-optimized for E. coli expression, synthesized with flanking attB recombination sites, and then blunt-end subcloned into pUC57-Kan to generate a Gateway-compatible entry clone ( Supplementary Figure S12 ). Appropriate mutations were introduced by site-directed mutagenesis (SDM), while domain deletions were introduced by PCR, followed by Gateway BP cloning into pDONR-201 (Invitrogen). The DdrC variants were then cloned into publicly available E. coli expression vectors by Gateway LR cloning. A custom Gateway pDEST vector that introduces an N-terminal His 14 -mOCR fusion tag (pDEST-SHmOCR) was created for the expression of ΔNTD DdrC and deposited to Addgene (plasmid #206874). Details and creation histories for all plasmids used in this study are summarized in Supplementary Table S1 .

Selenomethionine-derivatized (SeMet) DdrC variants were expressed from their corresponding expression plasmids ( Supplementary Table S3 ) in the methionine-auxotrophic strain E. coli B834(DE3) (Novagen, Madison, WI, USA). DdrC protein was derivatized with selenium during protein expression using the M9 SeMet high-yield media kit as per the manufacturer's protocol (Medicilon, Shanghai, China). Non-derivatized DdrC variants were expressed from their corresponding expression plasmids ( Supplementary Table S3 ) in Escherichia coli BL21(DE3) by growing transformed bacteria in LB media at 37°C to an OD 600 between 0.4 and 0.7. Once the desired cell density was reached, cells were cooled on ice for 20 min, then IPTG was added to the media at a final concentration of 1 mM to stimulate protein production. The bacterial culture was then grown at 16°C for an additional 16 hours.

All downstream purification was performed at 4°C or on ice. For all DdrC variants except ΔNTD DdrC, the bacterial cells were harvested from culture by centrifugation, then washed and resuspended in Buffer A (800 mM NaCl, 5% (v/v) glycerol, 20 mM Tris, pH 8.0) at a final cell density of ∼0.1 g cells/ml. The cell suspension was then lysed by French press in the presence of protease inhibitors (1 mM Benzamidine, 1 mM PMSF, 300 nM Aprotinin, 10 μM Leupeptin, 1 μM Pepstatin A), then clarified by centrifugation at 48,000xg and filtered through a 0.45 μm PES filter. The soluble lysate was applied to a Proteindex EDTA resistant Ni-IMAC column (Marvelgent Biosciences Inc.) and washed with 40 column-volumes (CV) of Buffer A and 40 CV of 6 mM imidazole in Buffer A prior to eluting DdrC with 210 mM imidazole in Buffer A. To remove the N-terminal affinity tag, DdrC was exchanged into Buffer K (200 mM Na 2 SO 4 , 20 mM Na 3 Citrate/Citric Acid, pH 6.5) using a HiPrep 26/10 desalting column (Cytiva, LLC), then incubated with His-tagged TEV protease for 16 hours at a 1:15 TEV:DdrC molar ratio. To prevent ionic column interactions, 2 M NaCl dissolved in Buffer A was slowly added to the reaction mixture until a final NaCl concentration of 600 mM was reached. Untagged DdrC was then isolated from the reaction mixture by passing the solution over an equilibrated Ni-IMAC column, collecting the flow-through, and exchanging the protein into Buffer K. Finally, DdrC was concentrated in Buffer K using a 5 kDa MCO Vivaspin Turbo 15 PES concentrator (Sartorius AG) spun at 3000–4200×g in 10 min intervals until the desired DdrC concentration was reached ( Supplementary Table S3 ). Protein was aliquoted into single-use samples, flash-frozen, and stored at –80°C until needed. DdrC concentration was calculated from measured A 280nm values using the expected molar absorption coefficient for each DdrC variant. Purity profiles for each DdrC variant are available in Supplementary Figure S13 .

ΔNTD DdrC was purified the same way as other DdrC variants, except Buffer B (2 M NaCl, 5% (v/v) glycerol, 20 mM Tris, pH 8.0) was used in place of Buffer A and the Ni-IMAC column was washed longer, with lower concentrations of imidazole (0.45 mM for 40 CV and 0.9 mM for 40 CV). In addition, tag removal by TEV protease was done in Buffer C (50 mM KCl, 50 mM Tris pH 8.0, 0.5 mM EDTA) instead of Buffer K. Unlike the other DdrC variants, ΔNTD DdrC precipitated out of solution following tag cleavage, but the protein was readily re-solubilized by adding 2× Buffer B to the reaction mixture at a 1:1 volume ratio. Cleaved ΔNTD DdrC was then isolated, buffer exchanged, concentrated and stored the same way as all other DdrC variants.

The SNM1a nuclease was expressed and purified as previously described, then stored at 128 μM in SNM1a Storage Buffer (200 mM NaCl, 10 mM Tris pH 7.5, 5% glycerol, 0.5 mM TCEP) at –80°C ( 27 ).

Generating DNA ligands for binding studies

Short 22-bp nicked and un-nicked dsDNA fragments were generated by annealing complimentary DNA oligonucleotides together. Oligonucleotides MJ8616, MJ8617 and MJ8618 were annealed to generate the nicked DNA ligand, while MJ8631 and MJ8618 were annealed to generate the un-nicked DNA ligand ( Supplementary Table S2 ). Similarly, MJ8381 and MJ8383 were annealed together to generate a 48-bp dsDNA fragment ( Supplementary Table S2 ). Oligonucleotides were annealed by dissolving synthesized oligos in TE buffer (10 mM Tris, pH 8.0, 1 mM EDTA) and mixing them together at a final equimolar concentration of 5 μM. The mixture was then heated to 95°C and slowly cooled to 20°C at a rate of 0.5°C/min before aliquoting and storing the annealed DNA at –20°C.

Supercoiled (RFI) and randomly nicked (RFII) ΦX174 plasmid DNA was obtained directly from New England Biolabs (NEB). The supercoiled plasmid was digested with Nt.BspQI (NEB) and FD-Eco47I (Thermo Scientific) according to the enzyme manufacturer's protocols to generate single-nicked and linear ΦX174 DNA respectively.

Supercoiled pUC19 plasmid was isolated by midi-prep (Presto™ Midi Plasmid Kit, Geneaid) from a culture of transformed E. coli DH10B (Top10) that was grown to an OD 600 of 1.8. Mutant pUC19 lacking one of three BssSI sites was generated by site-directed mutagenesis (SDM) using primers MJ8482 and MJ8483 ( Supplementary Table S2 ), then verified by Sanger sequencing. Supercoiled mutant pUC19 was then generated using the same method as WT pUC19. Both WT and mutant pUC19 were digested with nicking endonucleases that introduce exactly 1, 2, 3 or 4 ss-breaks on pUC19. The nicks in the 2-nick pUC19 were then re-sealed with T4 DNA ligase to generate relaxed, unnicked pUC19 plasmid. All pUC19 plasmids were then linearized with either SalI or SacI blunt-end restriction endonucleases. After each reaction step, the enzymes were heat-inactivated, and the reaction mixture was sufficiently diluted to overcome buffer incompatibilities of downstream enzymes. Optimized reaction conditions for each enzymatic step are provided in Supplementary Figure S3 . To generate nicked dephosphorylated pUC19 plasmid, the 3-nick variant of pUC19 was digested with rSAP (NEB) according to the manufacturer's protocol, except at a variable ratio of 0.25–4 units of rSAP per μg of pUC19. The absence of terminal 5′ phosphates was verified by digestion of 2 nM pUC19 with 200 nM SNM1A exonuclease in Buffer F (75 mM potassium acetate, 10 mM magnesium acetate, 1 mM DTT, 0.1 mg/ml BSA, 50 mM Tris/acetate, pH 7.2) for 1 h at 37°C ( Supplementary Figure S2 ).

All ΦX174 and pUC19 plasmid ligands destined for DdrC binding assays were diluted with TE buffer to a final DNA concentration of 35 ng/μl, then aliquoted and stored at –20°C. DNA concentration was calculated from A260 measurements (Nanodrop 2000c, Thermo Scientific).

Electrophoretic mobility shift assay

All EMSA mixtures were set up and incubated at 4°C. First, DdrC was serially diluted from storage conditions with Buffer K (200 mM Na 2 SO 4 , 20 mM Na 3 Citrate/Citric Acid, pH 6.5) to 2× of the final desired protein concentration. The 2× DdrC solutions were then diluted to 1× with DNA and other buffer components to yield a final reaction mixture of DdrC in Buffer M (100 mM Na 2 SO 4 , 1 mM MgCl 2 , 0.1 mg/ml BSA, 20 mM Na 3 citrate/citric acid, pH 6.5) with either 2 nM of plasmid DNA or 100 nM of annealed DNA oligonucleotide. The EMSA reaction mixtures were then incubated for 60 min to allow DdrC to bind DNA. For the Proteinase K control, Proteinase K was then added to a final concentration of 0.2 mg/ml and incubated at 37°C for 10 min to digest DdrC. The reaction mixtures were then mixed with 6x DNA loading dye (0.025% w/v Bromophenol Blue, 30% v/v Glycerol) to a 1× final concentration. For the plasmid-based assays, 6 μl of the mixtures (10 fmol plasmid DNA) were run on a 1% w/v agarose gel in a low-pH TAE buffer (40 mM Tris, 44 mM acetic acid, 1 mM EDTA, pH 6.0) at a field strength of 4 V/cm for 2–3 h at 4°C. For the annealed oligonucleotide-based assays, 12 μl of the mixtures (1 pmol DNA) were run on a 10% native PAGE gel in the low-pH TAE buffer at a field strength of 15 V/cm for 50 min at room temperature. All gels were stained with ethidium bromide.

EMSA gels were quantified by integrating the band intensities corresponding to unbound DNA ( ⁠|${{I}_{UB}}$|⁠ ), High-affinity complex ( ⁠|${{I}_{HA}}$|⁠ ) and Low-affinity complex ( ⁠|${{I}_{LA}}$|⁠ ) in each gel lane using Image Lab software (Bio-Rad Laboratories, Inc.). The integration ranges for |${{I}_{UB}}$|⁠ , |${{I}_{HA}}$| and |${{I}_{LA}}$| were different for each DNA ligand used ( Supplementary Figure S14 ). In some cases, the signal corresponding to the UB species bleeds into the range that is integrated as the HA species due to limitations in gel resolution. This results in some proportion of the |${{I}_{UB}}$| signal being falsely integrated as |${{I}_{HA}}$|⁠ . The exact proportion of |${{I}_{UB}}$| that is falsely integrated can be calculated from the ratio of |${{I}_{HA}}$| to |${{I}_{UB}}$| signal in the 0 nM DdrC sample ( ⁠|$I_{HA}^0/I_{UB}^0$|⁠ ) since all integrated intensity in this sample must correspond to unbound DNA. The corrected |${{I}_{HA}}$| signal ( ⁠|$I_{HA}^{Corr}$|⁠ ) was therefore calculated as follows:

The LA signal must also be corrected due to a gel staining artifact where the regions near gel wells have a higher background intensity from the rest of the gel, resulting in an inflated |${{I}_{LA}}$| signal. In this case, the proportion of total DNA signal ( ⁠|${{I}_{HA}} + {{I}_{LA}} + {{I}_{UB}}$|⁠ ) being falsely integrated as |${{I}_{LA}}$| can be calculated from the ratio of |${{I}_{HA}}$| to |${{I}_{Total}}$| signal in the 0 nM DdrC sample ( ⁠|$I_{LA}^0/( {I_{HA}^0 + I_{LA}^0 + I_{UB}^0} )$|⁠ ). The corrected |${{I}_{LA}}$| signal ( ⁠|$I_{LA}^{Corr}$|⁠ ) was therefore calculated as follows:

Finally, the corrected intensities were used to calculate the proportion of DNA that is bound in the HA state and the LA state:

Nuclease protection assay

First, DdrC or PprA protein was serially diluted from storage conditions with Buffer K (200 mM Na 2 SO 4 , 20 mM Na 3 citrate/citric acid, pH 6.5) to 4x of the final desired protein concentration. Nicked or linear pUC19 plasmid and other buffer components were added to the protein dilutions to yield 1× DdrC or PprA with 2 nM pUC19 in a buffered background of 1× Buffer M (100 mM Na 2 SO 4 , 1 mM MgCl 2 , 0.1 mg/ml BSA, 20 mM Na 3 citrate/citric acid, pH 6.5) and 1× Buffer F (75mM potassium acetate, 10 mM magnesium acetate, 1 mM DTT, 0.1 mg/ml BSA, 50 mM Tris/acetate, pH 7.2). The mixtures were incubated at 4°C for 1 h to allow for protein–DNA complex formation. Then, either SNM1a or BglI (Fast-Digest, Thermo Scientific) were added to the mixtures at final concentrations of 200 nM for SNM1a and 0.05U/μl for BglI from 10×-concentrated stock solutions. The nuclease reactions were incubated at 37°C for 1 h. Proteinase K was then added at a final concentration of 0.2 mg/ml and incubated at 37°C for 10 min to digest the nucleases, DdrC and PprA. Finally, the reaction mixtures were loaded and run on an agarose gel as described in the ‘Electrophoretic mobility shift assay methods’ section.

Differential scanning fluorimetry

To optimize buffer conditions for DdrC stability, a solution of 2x SYPRO ORANGE dye (Protein Thermal Shift™ Dye Kit, Applied Biosystems) and 175 μM WT DdrC was prepared in Buffer A (800 mM NaCl, 5% (v/v) Glycerol, 20 mM Tris, pH 8.0). The protein-dye solution was mixed at a 1:1 volume ratio with various ionic salt or buffered pH solutions in a 96-well qPCR plate (Durham Salt and pH Screens, Molecular Dimensions). All mixtures were prepared and kept at 4°C. Fluorescence in each well was monitored at 520/558 nm on a qPCR thermocycler (QuantStudio™ 3, Applied Biosystems) as the temperature was increased from 12°C to 99°C at a rate of 0.05°C/s. To identify the melting temperatures ( ⁠|${{T}_m}$|⁠ ) for each sample, signal fluctuations were first smoothed using the Protein Thermal Shift Software (Applied Biosystems), resulting in useable |$F( T )$| curves. |${{T}_m}$| values were then calculated by identifying all positive peaks of |$dF/dT$| using the SciPy signal processing library in Python ( 28 ).

To assay the relative stabilities of different DdrC variants, a solution of 2× SYPRO Orange Dye in Buffer K was mixed at a 1:1 volume ratio with 175 μM of each DdrC variant in Buffer K. The thermal melt profile of each DdrC variant was then measured and analyzed the same way as for the buffer optimization assays.

To measure the oligomeric state of DdrC, 100 μl of each DdrC variant was injected directly from storage conditions ( Supplementary Table S3 ) onto a Superdex 200 Increase 10/300 GL size-exclusion column (SEC) using the ÄKTA Pure chromatography system (Cytiva, LLC) running Buffer K at 0.5 ml/min. Absolute molecular weight was determined by SEC-coupled multi-angle light scattering analysis (SEC-MALS). The size-exclusion column was connected in-line to a Dawn HELEOS II MALS detector equipped with a 662 nm laser source and an Optilab T-rEX differential refractometer with a 658 nm LED source (Wyatt Technology). Molecular weight was calculated by Zimm plot analysis using the ASTRA software (v6.1.5.22; Wyatt Technology).

Crystallization and X-ray diffraction

All protein crystals were grown by the hanging-drop vapor-diffusion method at 20°C. The recombinant DdrC proteins that were used for crystallization trials are summarized in Supplementary Table S3 . When screening for initial crystallization conditions, 1 μl of DdrC was mixed with 1 μl of varying precipitant solutions from different commercial screening kits. The mixed drop was suspended over 1 ml of an ammonium sulfate dehydrating solution in a sealed chamber. Conditions that yielded DdrC crystals were optimized for X-ray diffraction quality by varying: the initial DdrC concentration, the volume ratio of protein solution to precipitant solution, and the composition of the dehydrating solution. In some cases, optimized crystallization conditions were further subjected to secondary screens of additive solutions to improve crystal quality. Final crystallization conditions of the three deposited DdrC structures (PDB 7UDI, 8U0G and 8U1J) are summarized in Supplementary Table S4 .

Crystals were harvested with nylon cryo-loops and flash-frozen in liquid nitrogen. Then, crystals were mounted in a nitrogen cryo-stream at 100K during data collection. X-ray diffraction data was collected from both synchrotron and Cu K-α rotating anode radiation sources. Synchrotron data was collected at beamlines CMCF-ID and CMCF-BM of the Canadian Light Source (CLS) synchrotron, while Cu K-α data was collected on a MicroMax-007 HF generator (Rigaku Corp.). Detailed collection parameters for each of the three deposited DdrC structures are provided in Supplementary Table S5 .

Crystal structure solution

All data sets were integrated and scaled using autoPROC (Global Phasing Ltd) ( 29 ). For the crystal structure corresponding to PDB 7UDI, an initial electron density map was generated by experimental SAD phasing and density modification using Phenix AutoSol ( 30 ). A model of the asymmetric unit containing two DdrC chains was built into the density map using Buccaneer, then refined iteratively in Coot and Phenix Refine ( 30–32 ). The atomic coordinates and structure factors were deposited in the Protein Data Bank under the accession 7UDI (DOI: 10.2210/pdb7UDI/pdb). Residues and sidechains with missing electron density were modeled into the 7UDI crystal structure using Rosetta Remodel with the REF2015 score function ( 33 , 34 ). The L131M/L184M mutations were also reverted to WT to yield a complete model of a FL WT DdrC dimer. This model was deposited in ModelArchive under the accession ma-nmyn0 (DOI: 10.5452/ma-nmyn0).

For the crystal structures corresponding to PDB 8U0G and 8U1J, an initial electron density map was generated by molecular replacement (MR) of the search model PDB 7UDI using Phenix Phaser ( 30 ). In the case of 8U1J, the MR search model was limited to the first 98 residues of a single chain of DdrC. The crystal structures of both 8U0G and 8U1J were built and refined the same way as 7UDI, then deposited to the PDB (DOI: 10.2210/pdb8U0G/pdb, 10.2210/pdb8U1J/pdb). Relevant data processing and model refinement statistics are available in Table 3 .

Domain and symmetry analysis

Inter- and intra-molecular contacts within the DdrC dimer were identified from the filled 7UDI crystal structure by automated algorithms in PyMOL (Schrödinger, LLC). To identify possible domain boundaries by structural homology, the DdrC structure was queried for structural similarity against the entire PDB databank using the DALI protein structure comparison server ( 35 ). The DALI results were then analyzed using DALIview (DOI: 10.5281/zenodo.8435478) to reveal structurally similar domain families.

Axes of symmetry were identified within the DdrC dimer by calculating the midpoint positions in 3D space between every atom in chain A and its analogous atom in chain B. The list of 3D midpoints was grouped according to DdrC domains, then subjected to Principal Component Analysis (PCA), yielding a list of PCA eigenvectors for each DdrC domain. The longest eigenvector for each domain corresponds to a fitted C2 axis of symmetry when plotted in 3D space.

To identify the source of DdrC dimer asymmetry, the angular differences between chain A and chain B backbone torsion angles were calculated for all phi ( ⁠|$\varphi$|⁠ ) and psi ( ⁠|$\psi$|⁠ ) angles. The absolute angle differences at each residue position ( ⁠|$| {\Delta \varphi } | + | {\Delta \psi } |$|⁠ ) were mapped onto the structure in PyMOL according to a color gradient.

Computational docking

Electrostatic surface potentials were calculated for experimental and theoretical DdrC structures using the APBS software suite ( 36 ).

To generate an atomic model of DdrC in complex with un-nicked intact dsDNA, a DNA duplex of arbitrary sequence and length was docked onto the filled 7UDI crystal structure using the rigid protein/flexible DNA algorithm, Paradock ( 37 ). The top-scoring output model from Paradock was then refined against the Rosetta REF2015 score function through 1000 stochastic repetitions of the Rosetta relax protocol ( 34 , 38 ). The top-scoring model was deposited to ModelArchive under the accession ma-urph3 (DOI: 10.5452/ma-urph3) and used for downstream analysis.

A model of DdrC in complex with a 21 bp nicked DNA duplex was predicted using the RosettaFoldNA neural net model (v0.1) from the amino acid sequence of DdrC and the nucleotide sequence of 3 complimentary DNA oligonucleotides (CGTCATCACCGAAACGCGCGA, TCGCGCGTTTCGG and TGATGACG) ( 39 ). The top-scoring output model was then refined using the same method as for the un-nicked DNA model, except with an explicit C2 axis of symmetry. The top-scoring model was deposited to ModelArchive under the accession ma-50nj9 (DOI: 10.5452/ma-50nj9).

Finally, a model of DdrC in complex with a terminal dsDNA end was generated from the nicked dsDNA model by removing nucleotides that are downstream from the nick. The resulting model was refined and deposited to ModelArchive under the accession ma-otnza (DOI: 10.5452/ma-otnza).

UV-C survival assay

The native DNA sequence of D. radiodurans ddrC was synthesized in the form of either WT, NTD-mut or CTD-mut variants together with the Deinococcal constitutive promoter PDR_1261 ( Supplementary Figure S18 ) ( 40 ). The synthesized DNA fragments were then subcloned into pRad1 at XhoI / XbaI restriction sites to generate a series of ddrC complementation plasmids ( 41 ). Plasmid details are summarized in Supplementary Table S1 . D. radiodurans R1 strains harboring ΔuvsEΩhygro and ΔuvsEΩhygroΔddrCΩkan genomic deletions were obtained from Dr. Fabrice Confalonieri and transformed with plasmid as previously described ( 25 , 42 ). Transformants were selected and cultured in the presence of 50 μg/ml Hygromycin-B, 6 μg/ml Kanamycin or 3 μg/ml Chloramphenicol, as appropriate. Each transformant was cultured in liquid 2×TGY media at 32°C to an OD 600 of 1.0, then serially diluted, spot plated, and exposed to a UV-C light source (254 nm) at a fixed distance for varying lengths of time. UV exposure dose was calculated from radiometer dose rate measurements. The UV-treated TGY-Agar plates were incubated at 30°C for 60 h, then imaged and analyzed. The surviving fraction of D. radiodurans was measured in triplicate by comparing the CFU counts at each UV-C dose to unirradiated bacteria.

DdrC compacts circular dsDNA through interactions with single-strand breaks

When DdrC is incubated with supercoiled, relaxed, or linear forms of ΦX174 plasmid dsDNA, the DNA mobility is shifted into the well at high DdrC concentrations (Figure 1A – D ). This suggests the formation of a large intermolecular complex. It is unclear whether this species is of any biological relevance. At lower DdrC concentrations (<300 nM DdrC per nM DNA), DdrC forms smaller complexes with DNA, as the bound species migrates into the gel.

Gel motility shifting of dsDNA upon DdrC binding. 2 nM of ( A ) supercoiled, ( B ) linear, ( C ) randomly nicked and ( D ) single-nicked ΦX174 dsDNA plasmids incubated with DdrC at varying concentrations. ( E ) Addition of Proteinase K to a pre-formed DdrC-DNA complex with randomly nicked ΦX174.

Interestingly, the electrophoretic mobility of this smaller species is shifted differentially by DdrC depending on the starting plasmid topology. Both linear and supercoiled ΦX174 are shifted to a discrete species in the presence of DdrC (Figure 1A , B ), but, the shift in mobility of supercoiled DNA is progressive, whereas that of linear DNA is sudden ( Supplementary Figure S1 ). In other words, supercoiled plasmid appears to have multiple DdrC binding sites, whereas linear plasmid only has one.

The most surprising binding behaviour across the different ΦX174 isomers is the observation that relaxed ΦX174 results in an increase of plasmid mobility. This is unexpected, as DNA binding proteins typically impede the mobility of their DNA binding partners on a gel, rather than increase it. An increase in DNA mobility can only occur in three situations: (i) the DNA/protein complex is more negatively charged than the DNA on its own, (ii) the DNA sequence is physically shortened by nuclease digestion or (iii) the DNA undergoes topological changes which lowers its radius of gyration.

It is highly unlikely that the increased DNA mobility is the result of a more negative net charge upon complexation with DdrC, as DdrC has a theoretical p I of 9.7 and is expected to have a net charge of +5 under Buffer M conditions. To examine whether the change in mobility is due to nuclease activity, Proteinase K was added to the DNA following incubation with DdrC (Figure 1E ). The addition of Proteinase K to a pre-formed DdrC-DNA complex restores the mobility of the plasmid to its unbound state, demonstrating that the increase in mobility is not a result of nuclease degradation. It has been shown previously by TEM that DdrC induces DNA compaction of relaxed plasmid DNA ( 25 ). We propose that the fast-moving species formed upon the addition of DdrC is in fact compacted plasmid. Interestingly, compaction of ΦX174 plasmid by DdrC is observed to a much greater degree when the plasmid contains many randomly generated single-strand breaks compared to plasmid harboring a single enzymatically-produced nick (Figure 1C , D ). So, plasmid compaction by DdrC appears to be dependent on the presence of nicks.

DdrC induces DNA compaction through the bridging of two distal nick sites

Since plasmid compaction seems to be dependent on the presence of ss-breaks, it seems very likely that DdrC is recognizing and binding directly to DNA nicks. We tested this assumption by assaying the binding characteristics of DdrC to a short 22-mer DNA duplex with and without an internal ss-break (Figure 2A ). As expected, a discrete band shift was observed only when a nick was present. This result demonstrates that DdrC recognizes and binds to ss-breaks directly. Furthermore, it appears that DdrC is stabilizing the nicked DNA duplex as the DNA transforms from a smeared, diffuse band in the unbound state to a sharp, discrete band in the bound state. Stoichiometrically, the DNA band was nearly fully shifted at a ratio of 2 DdrC monomers per nick, suggesting that DdrC binds to the DNA as a dimer. But this does not explain the mechanism by which DdrC compacts plasmids. Binding of DdrC to the 22-mer duplex results in an upwards band shift, as opposed to a downwards shift, as observed with ΦX174 plasmid harboring multiple nicks. This is likely because the 22-mer DNA fragment is too short to become compacted. Also, it appears that the degree of compaction may be dependent on the number of nicks available on the DNA.

Characterization of the interactions between DdrC and single-strand breaks. ( A ) DdrC-induced motility shift of a 22 bp dsDNA fragment at 100 nM with an internal nick that is either present or absent. ( B ) DdrC-induced motility shift of pUC19 plasmid at 2 nM that has been pretreated with either Nt. BspQI or Nb.BssSI nicking endonucleases. ( C ) SNM1a exonuclease or BglI endonuclease digestion of nicked pUC19-DdrC complexes at varying DdrC concentrations. ( D ) DdrC-induced motility shift of nicked pUC19 that has been dephosphorylated with rSAP. ( E ) Motility shift of variably-nicked pUC19 plasmid following incubation with 75 nM of DdrC. Terminal 5′ phosphates at single-strand break sites are depicted with red circles. Relative positions of nicks on plasmid schematics are to scale. ( F ) Proposed interpretation of plasmid compaction assay.

Since multiple random nicks on ΦX174 plasmid yields a smear of compacted species, while a single nick yields almost no compaction, we hypothesized that a plasmid harboring a discrete number nicks would result in compaction to a discrete species. To test this hypothesis, DdrC was incubated with pUC19 that has been relaxed from its supercoiled state using Nt.BspQI or Nb.BssSI nicking endonucleases, which introduce exactly one or three nicks on pUC19, respectively (Figure 2B ). Like with the ΦX174 plasmid, no compaction was observed when there was only one nick present. But when three nicks were present, DdrC compacted the pUC19 plasmid to a single, discrete species, as expected. This result demonstrates that the mechanism of plasmid compaction by DdrC is dependent on the number of available nicks.

Given that DdrC clearly binds to a short, nicked duplex (Figure 2A ), it is likely that the 1-nick pUC19 plasmid is also being bound by DdrC, despite the lack of a visible band shift. We hypothesize that a single nick is sufficient for DNA binding, but insufficient for DNA compaction, so the plasmid remains in a circular, relaxed topology when bound by DdrC. To verify that DdrC binds to the ss-break on the 1-nick pUC19 plasmid, the plasmid was incubated with varying concentrations of DdrC, then treated with either an SNM1a, or BglI nucleases (Figure 2C ). SNM1a is a 5′→3′ exonuclease that initiates digestion from nick sites ( 27 , 43 ), while BglI is a is sequence-specific endonuclease that happens to digest pUC19 at two remote sites that are distant from the three engineered nicks. Under our assay conditions, DdrC protects DNA from SNM1a exo-digestion, but not BglI endo-digestion. In contrast, the DNA-binding protein PprA from D. radiodurans , which is known to form protein filaments, inhibits both endo- and exo-nuclease activity under the same conditions ( Supplementary Figure S15 ) ( 44 , 45 ). These findings demonstrate that DdrC binds to dsDNA directly at the site of the ss-break site and nowhere else on the plasmid. As such, the lack of a downwards band shift in the 1-nick pUC19 plasmid is not due to a lack of DNA binding, but because a single nick is insufficient for the DdrC compaction mechanism.

To further investigate the mechanism of nick recognition, we examined the requirement of a 5′ terminal phosphate for DdrC compaction, since the presence of a free 5′ phosphate chemically differentiates nicked from unnicked dsDNA, and dedicated phosphate recognition sites have been identified in a large subset of proteins in the PDB ( 46 ). First, terminal 5′ phosphates were removed from the 3-nick pUC19 substrate using varying amounts of Shrimp Alkaline Phosphatase (rSAP). SNM1a, a 5′ phosphate-dependent exonuclease, was used to probe for available 5′ phosphates on the rSAP-treated pUC19 samples. No SNM1a digestion was detected when treating pUC19 with 4 U rSAP/μg DNA, indicating that there are no available 5′ phosphates in the 4 U/μg population of nicked pUC19 ( Supplementary Figure S2 ). This sample of pUC19 was then incubated with DdrC (Figure 2D ). Treatment of 3-nick pUC19 with rSAP has no effect on subsequent DNA compaction by DdrC. So the mechanism of nick binding and plasmid compaction by DdrC must involve a mechanism that does not rely on interactions with a terminal 5' phosphate. Many DNA lesion sensing proteins evolved to exploit the altered mechanical properties of DNA at the site of lesions ( 47 ). We hypothesize that DdrC may rely on a similar mechanical sensing mechanism since a DNA duplex would have higher conformational freedom at the site of a ss-break.

The data presented so far strongly implies that there is a relationship between the number of available of nicks on a plasmid and the degree to which that plasmid becomes compacted by DdrC. We have observed that plasmid with a single nick does not undergo significant compaction by DdrC, whereas a plasmid with exactly 3 nicks is compacted to a single species, and a randomly nicked plasmid is compacted to an even greater degree with a large distribution in gel mobility.

To examine the relationship between DNA compaction and the number of available single-strand breaks, a series of variably nicked pUC19 plasmids were generated. The sequence of pUC19 allows for the addition of evenly spaced nicks using commercially available nicking endonucleases. This was possible because the pUC19 sequence contains 1 Nt.BspQI site, 3 Nb.BssSI sites and 4 Nb.BstNBI sites. Then, a variant of pUC19 was generated via mutagenesis to contain only two Nb.BssSI sites to prepare a plasmid with exactly 2 nick sites,.

Nt.BspQI, Nb.BssSI and Nb.BstNBI endonucleases were then used to prepare the series of topologically relaxed pUC19 plasmids containing 0, 1, 2, 3 and 4 single-strand breaks ( Supplementary Figure S3 ). This series of nicked pUC19 plasmids were then incubated with DdrC (Figure 2E ). As expected, it was observed that DdrC induces compaction of the nicked plasmids to discrete species and that the degree of compaction increases with the number of available nicks.

To measure the degree of compaction, a pUC19 ‘compaction marker’ was prepared and run on the gel alongside the DdrC-compacted species (Figure 2D ). The compaction marker was generated by nicking and subsequently re-ligating pUC19 plasmid, yielding a mixture of at least five supercoiled topoisomers of pUC19. This was possible as circular, nicked DNA can freely rotate around the strand opposite from the nick due to random thermal motion, leading to spontaneous over- or under-winding of the DNA duplex. Ligation of the nicks then traps the molecules in discrete supercoiled states and produces a set of identical plasmids that differ only in their topological linking number (Δ L k ) by positive or negative integer values ( 48 , 49 ). The distribution of the Δ L k values is Gaussian and can be altered by varying the temperature during ligation ( 48 , 49 ). This plasmid mixture effectively acts as a quantized DNA marker for pUC19 supercoiling with linking numbers (Δ L k ) between 0 and 4. The mobility of the DdrC-compacted species was then measured relative to the compaction marker (Figure 2D ). Interestingly, the mobility of the DdrC-compacted species also appears to be ‘quantized’ as they only seem to take on values corresponding to specific pUC19 topoisomers in the marker (Table 1 ). In short, a single nick leads to an apparent Δ L k of 0. Two and three nicks both result in an apparent Δ L k of 1, and four nicks results in a Δ L k value of 2.

Apparent linking numbers of DdrC-bound pUC19 plasmids—circular

a Mobility distances are measured relative to the Δ L k = 0 and Δ L k = 4 samples in the topo marker.

b Linking numbers are calculated by linear interpolation from Topo marker standards.

Each of the five species in the compaction marker is expected to have a set number of writhe points, which are figure-8 structures that form spontaneously to resolve the torsional strain of supercoiling ( 50 ). These differences in plasmid shape account for the differences in gel mobility. Since the mobility of the DdrC-compacted plasmids appear to match the mobility of specific pUC19 topoisomers, we hypothesize that the DNA structures formed upon DdrC binding are similar to the writhe point structures that arise in supercoiled plasmids. It is also apparent that DdrC-mediated compaction only occurs when there are two or more nicks available on the plasmid, after which point, the apparent linking number of the bound pUC19 increases by one with every two additional nicks. These observations offer insight into the mechanism of DNA compaction by DdrC (Figure 2F ). Simultaneous binding of two distal nick sites by a single protein would produce a topological constraint on DNA that looks like a single DNA writhe point by agarose gel electrophoresis. Since the apparent linking number of the bound pUC19 increases by one with every two additional nicks, we can conclude that each unit of DdrC recognizes and binds to two nicks on the plasmid. As such, these data strongly suggest that the mechanism of DdrC plasmid compaction occurs through bridging two distal nick sites into close spatial proximity.

Although we did not detect any binding to unnicked, relaxed pUC19, we did observe significant binding of DdrC to supercoiled pUC19 ( Supplementary Figure S4 ). The same behavior was observed with ΦX174 plasmid ( Supplementary Figure S1 ). Unlike binding to other dsDNA substrates, the degree of band shifting appears to be progressive in the case of supercoiled plasmid. In other words, a higher concentration of DdrC yields a more prominent shift, up to a saturation point. This correlation indicates that each supercoiled plasmid can be bound by multiple molecules of DdrC. Supercoiled plasmid extracted from E. coli is expected to contain multiple writhe points. It is very likely that DdrC is binding to the writhe points of supercoiled plasmids, as these DNA structures may be the same structures that are induced when DdrC bridges two nicks during plasmid compaction. It follows then that the topology of DdrC-compacted DNA resembles the topology of supercoiled DNA; however, it is unclear whether DdrC actively supercoils DNA or if it simply induces a writhe point-like structure without over- or under-winding the DNA duplex.

DdrC circularizes linear dsDNA and compacts it in the presence of ssDNA breaks

The binding of DdrC to linear ΦX174 plasmid results in an upwards band shift to a single, discrete position (Figure 1B ). This result indicates that the protein–DNA complex is assembled from a fixed stoichiometric ratio of DdrC to DNA. Given that DdrC binds directly to single-strand breaks, it is highly likely that DdrC binds linear DNA fragments at double-strand break sites, which would explain why the complex has a discrete stoichiometry of DdrC to plasmid.

To characterize how DdrC interacts with double-strand breaks, we assessed whether DdrC has a preference for overhang type at the terminal ends of linear DNA. In this assay, one ds-break was introduced into pUC19 plasmid harboring either 0, 2 or 4 nt overhangs (5′) using SmaI, NdeI and SalI endonucleases, respectively. The varying overhang DNA fragments were then incubated with varying concentrations of DdrC and the shift profiles were visualized on a gel (Figure 3A ). It is clear that DdrC has a significantly higher affinity for blunt ds-breaks when compared to overhangs: ∼2-fold higher when compared to a 2 nt overhang, and ∼7-fold when compared to a 4 nt overhang.

Characterization of the interactions between DdrC and double-strand breaks. ( A ) DdrC-induced motility shift of pUC19 plasmid at 2 nM that has been pre-treated with three different endonucleases: SmaI, NdeI and SalI. ( B ) Motility shift of blunt-end linear pUC19 compared to unbound, circular pUC19 ( C ) Motility shift of blunt-end linear pUC19 plasmids following incubation with 75 nM of DdrC. Linearized pUC19 plasmids were relaxed with nicking endonucleases to harbor a specific number of nicks. Nick sites are represented with red triangles and their relative positions on the linear plasmid schematics are to scale. ( D ) Proposed model of linear plasmid circularization and compaction by DdrC.

Despite differences in affinity, the shifted DNA migrates to the same discrete position regardless of overhang type. Interestingly, the gel migration position of bound, linear pUC19 appears to be the same as unbound, relaxed circular pUC19 (Figure 3B ). This suggests that the topology of the two species is the same. In other words, DdrC appears to be circularizing linear DNA. If this is the case, then we would expect linear pUC19 harboring single-strand breaks to become compacted in the same way as circular nicked pUC19.

To test this hypothesis, we generated blunt-end, linear pUC19 harboring 0, 1, 2, 3 and 4 nicks ( Supplementary Figure S3 ). This series of linear plasmids was then incubated with DdrC (Figure 3C ). As expected, compaction is observed with the nick-harboring DNA. As with the circular plasmids, the degree of compaction scales with the number of available nicks on the plasmid (Table 2 ). This result strongly suggests that DdrC circularizes linear DNA via bridging of ds-breaks, then circularized plasmid can become compacted via bridging of ss-breaks (Figure 3D ). The nick-bridging model of plasmid compaction by DdrC suggests that each functional unit of DdrC has two DNA binding sites. Each binding site can recognize and bind to either a ss-break or ds-break.

Apparent linking numbers of DdrC-bound pUC19 plasmids—linear

Previously, it has been reported that DdrC has a higher affinity for ssDNA than dsDNA at a fragment size of 67-mer ( 25 ). In both cases, the DNA fragments were shifted to a discrete position on the gel, indicating that the complex is composed of a fixed stoichiometric ratio of DdrC to DNA. A fixed ratio suggests that DdrC is binding to both DNA fragments at the termini. We hypothesize that the apparent preference for ssDNA may be a symptom of selective DNA circularization by DdrC. Since the persistence length of dsDNA is about 50 nm (150 bp), while that of ssDNA is about 0.75nm (<5 nt), then a DNA length of 67-mer may be sufficient for circularization of ssDNA, but not dsDNA ( 51 ). Consequently, a 67-mer fragment of ssDNA may be able to contact both binding sites on DdrC, while a dsDNA duplex of the same length would only contact one. The ability of one ligand to contact more binding sites should correspond with a higher apparent binding affinity in a gel shift assay. To test this hypothesis, the experiment by Bouthier de la Tour et al.  was repeated using shorter 48-mer ssDNA and dsDNA ligands ( Supplementary Figure S16 ). Under these conditions, we do not observe a preference for either dsDNA or ssDNA, suggesting that in both cases, the DNA is only contacting a single binding site on DdrC. We hypothesize that the 48-mer ssDNA is either too short, too rigid, or contains secondary structures that prevent it from contacting both binding sites on DdrC.

DdrC is a homodimer with two structural domains

To gain insight on the molecular mechanism of DdrC nick detection, we solved the structure of DdrC by X-ray crystallography. Crystals of selenomethionyl (SeMet)-derivatized DdrC were grown and diffracted at the X-ray wavelength corresponding to the absorption edge of selenium. Although the resulting diffraction data was of high quality and resolution (Table 3 ), the anomalous signal did not have sufficient phasing power to recover the phases of measured structure factors. We suspect that too few methionine residues are to blame for the weak anomalous signal, as D. radiodurans DdrC only contains one internal methionine per monomer, and so a SeMet-derivatized DdrC crystal could only contain one structured selenium atom for every 231 native residues.

X-ray data collection and processing statistics

a Data collection statistics for high-resolution shell indicated in parentheses.

b Atoms with non-zero occupancy.

To overcome this obstacle, we introduced additional SeMet residues into DdrC at structured positions where SeMet substitution seems structurally and functionally safe. These two positions, Leu-131 and Leu-184, are frequently substituted to methionine in other close DdrC homologs that have highly conserved local sequence, and so L131M and L184M substitutions should have minimal effect on local and global folding in D. radiodurans DdrC ( Supplementary Figure S5 ). Crystals of SeMet-derivatized L131M/L184M DdrC were then grown, diffracted, and successfully phased, allowing for the solution and refinement of the crystal structure. This structure was deposited in the PDB under the accession code 7UDI (Figure 4A , Table 3 ). The structure of 7UDI was then used to phase diffraction data from the WT DdrC crystal by molecular replacement (MR). This structure was deposited in the PDB under accession code 8U0G ( Supplementary Figure S6 , Table 3 ).

Structural characterization of DdrC domains. ( A ) Crystal structure of the full-length DdrC homodimer colored according to predicted domain boundaries. Residues with missing electron density were modeled using Rosetta remodel and are represented with a dashed backbone. All inter- and intra-molecular sidechain interactions within the dimer are represented on the 1D domain map. ( B ) Differential scanning fluorimetry profiles of 3 truncated DdrC variants. The T m value corresponding to each dF/dT peak is indicated with an arrow. ( C ) Crystal structure of a proteolytically-degraded sample of DdrC. The integrity of the protein in the source crystallization drop was verified by SDS-PAGE pre- and post- crystallization and was compared to the integrity of the protein in the FL DdrC crystallization condition. The expected positions of possible DdrC species are indicated with arrows. ( D ) SEC-MALS analysis of the oligomeric state of three truncated DdrC variants.

Interestingly, both crystal structures had different lattice symmetries and crystal contacts. Despite the difference in lattice contacts, one common interaction interface persisted between the two structures (Figure 4A ). Conservation of this protein-protein contact strongly suggests that this is a biologically relevant interaction interface. We then determined by SEC-MALS that DdrC exists as a dimer in solution (Figure 4D , Table 4 ). Therefore, the interface identified by crystallography is most likely the dimerization interface.

SEC-MALS measurements of the oligomeric state of different DdrC variants in solution

From the crystal structure of DdrC, it appears that the protein is composed of two distinct domains, since the inter-and intramolecular contacts holding the dimer together are localized to either one of two regions: the N-terminal domain (NTD) that spans residues M1 to E110 and the C-terminal domain (CTD) that spans residues P111 to G231 (Figure 4A ). The first α-helix in the CTD contains a short stretch of 17 residues (P111-A126) that has an alternate conformation between the two DdrC chains. As such, we identified this section as a flexible ‘linker’. We generated the NTD and the CTD as independent proteins at these proposed domain boundaries (NTD: 1–110, CTD: 111–231), but the CTD exhibited very poor solubility. This poor solubility is likely the result of exposed hydrophobic residues, L117 and L121, that would otherwise interface with the NTD in the full-length protein. To improve solubility of the truncated domains, we generated NTD and CTD constructs with an altered domain boundary that neutralizes these exposed hydrophobic residues (NTD: 1–98, CTD: 99–231). These constructs were successfully expressed, purified, and remained stable in solution.

The presence of two distinct domains is supported by differential scanning fluorimetry (DSF) analysis, as full-length (FL) DdrC exhibits two melt peaks: one with a melting temperature ( T m ) of 40°C and one with a T m of 73°C (Figure 4B ). Each of the two proposed DdrC domains, NTD and CTD, were then analyzed under DSF separately as independent protein constructs. The thermal melt curves of the NTD and CTD constructs contained only one melt peak, each with a T m of 73°C and 37°C, respectively, matching the two T m values observed with FL DdrC. Both prominent melting events in the FL DdrC melt profile can be explained individually by the NTD and CTD melt profiles, demonstrating that the NTD and CTD are structurally distinct domains that fold independently of one another.

To investigate the possible role of each domain by structural homology, we queried the crystal structure of FL DdrC for structural similarity against the PDB databank. As expected, the NTD and CTD regions independently align to different structures, further supporting the hypothesis that the NTD and CTD of DdrC are distinct domains ( Supplementary Figure S7 ). The proteins that aligned most closely to the NTD were primarily members of the Dachshund homology domain (DHD) spanning residues ∼1–73 of DdrC. The CTD did not align to any specific domain family, but rather to an array of 3- and 4-helix bundles found broadly across the PDB. The degree of alignment of any characterized protein to either the NTD or CTD is too poor to extrapolate any meaningful functional significance.

NTD and CTD domains dimerize independently

To facilitate crystallization of FL DdrC, it was necessary to first optimize the buffer, pH and salt conditions of the protein storage solution for optimal protein stability ( Supplementary Figure S8 ). When storage conditions were sub-optimal, crystallization trials of WT FL DdrC did not yield any DdrC crystals, except on one non-reproducible occasion where a third crystal form was identified with a different unit cell and symmetry from the two previous crystal structures (PDB: 8U1J). Structure determination by MR revealed a DdrC dimer that was only comprised of residues 1–97 from the NTD (Figure 4C ). The remaining CTD residues (98–231) lacked any significant electron density. The relatively low refinement R -factors indicate that the NTD dimer model agrees with the experimental data and that the remaining 58% of the protein is either highly flexible under these conditions, or completely absent from the crystal lattice (Table 3 ). Given the expected structure of the CTD, residues 99–231 would not have fit into the observed crystal lattice ( Supplementary Figure S6 ), so it appeared as though DdrC was somehow crystallized without the CTD domain. The source crystallization drop was analyzed by SDS-PAGE, and it was confirmed that DdrC was indeed proteolytically digested in the drop, resulting in an apparent molecular weight that is consistent with residues 1–98 (Figure 4C ). This digestion was likely the result of an unknown contaminating protease. The high resistance of the NTD against proteolytic degradation is consistent with the previous observation that the NTD is more resistant to thermal denaturation than the CTD (Figure 4B ), implying that the NTD has high structural stability compared to the CTD.

The NTD crystal structure demonstrates that residues 1–98 of DdrC dimerize independently from the rest of the protein. In fact, the NTD dimer in the truncated crystal structure was nearly identical to the NTD dimer in the FL crystal structure (RMSD: 1.36Å). To validate that the NTD dimerizes in solution and not just in a stabilized crystal lattice, DdrC was expressed explicitly as a 1–98 truncation and purified. Upon measuring the oligomeric state by SEC-MALS, we found that the NTD does in fact dimerize in solution (Figure 4D , Table 4 ).

Despite the low stability of the CTD domain, we cannot rule out the possibility that the CTD can also dimerize independently of the rest of the protein. Attempts to express the CTD on its own (residues 99–231) yielded insoluble protein aggregates. However, we were able to express the CTD domain with a monomeric OCR (mOCR) fusion tag. The CTD remained stable and soluble following cleavage and removal of the fusion tag under optimized buffer conditions. SEC-MALS analysis revealed that, like the NTD, the CTD also dimerizes independently in solution (Figure 4D , Table 4 ).

Attempts to crystalize the CTD explicitly yielded no crystals, but it would be safe to assume that the dimerization interface of the CTD on its own would be the same interface as seen in the FL DdrC structure. Together, the NTD crystal structure with the SEC-MALS and DSF data demonstrate that the NTD and CTD domains fold and dimerize independently from each other.

The DdrC homodimer is asymmetric

When analyzed independently, the NTD and CTD each homodimerize symmetrically via a C2 axis of rotation. Curiously, the full DdrC homodimer comprising both NTD and CTD domains is itself asymmetric, with no global axes of symmetry between the two chains (Figure 5A ). In the context of the FL DdrC dimer, the C2 axes of the NTD and CTD are offset from each other by 46°. The same asymmetric structure is seen in both crystal forms despite different protein contacts and different chemical environments. So, this asymmetry is likely an endogenous structural feature, and not just a crystallographic artifact. Studying the nature of this asymmetry may reveal a molecular mechanism for DdrC function.

Analysis of structural asymmetry in the DdrC homodimer. ( A ) DdrC homodimer structure with highlighted midpoint positions between pairs of opposing homodimer atoms. Symmetry axes were fit by Principal Component Analysis (PCA) of midpoint positions for each domain. ( B ) Torsion angle differences (ΔΦ + ΔΨ) between both chains of the DdrC homodimer. The residues that most contribute to global asymmetry are indicated (★). ( C ) Loaded and relaxed conformations of the α6 helix from chains A and B, respectively. ( D ) Holding clasp residues in the disengaged and ( E ) engaged states. ( F ) Static forces in the DdrC homodimer counteract each other in a loaded mousetrap mechanism.

Comparing the internal coordinates between both DdrC chains, it is clear that the asymmetry can be attributed to only five residues within the interdomain region: residues 120–125 (Figure 5B ). The torsion angle differences between both DdrC chains at residues 120–125 account for all the global asymmetry in the DdrC dimer. In one DdrC chain, residues 120–125 lie within an intact helix, α6, which spans residues 111–136. In the other DdrC chain, α6 is deformed at residues 120–125, breaking the helix into two separate segments (Figure 5C ). Since the α6 residues clearly have a propensity to form a helix, we can assume that the broken α6 helix is under tension, like a bent spring.

The tension in the bent spring appears to be counteracted by a strong network of salt-bridges and H-bonds between the NTD and the CTD on only one face of the dimer (Figure 5E ). This ‘holding clasp’ mechanism involves the NTD from chain A (Gln-103, Glu-106) and the CTD from chain B (Arg-120, Asp-174). Meanwhile, the analogous clasp on the opposite face of the dimer is disengaged as the residues are not within range to form this interaction network (Figure 5D ). Interestingly, in the 7UDI crystal structure, the electron density is missing for residues 157–174 on the disengaged face of the dimer, suggesting that the CTD residues surrounding the holding clasp may be flexible when Asp-174 is not engaged.

We hypothesize that static forces within the DdrC homodimer counteract each other in a loaded mousetrap mechanism (Figure 5F ). A deformed α6 helix forms a loaded spring while an H-bond network forms a clasp that holds the spring under tension. It is possible that the mousetrap mechanism is a method for storing potential energy that can be used by DdrC to carry out its biological functions. If this is the case, then the mechanism must be triggered in response to a specific biochemical signal. This signal may be the terminal ends of DNA strands as we have shown that DdrC binds to ss- and ds-breaks with high affinity.

Dimer asymmetry may form the basis of the DdrC nick detection mechanism

To investigate the structural basis of DNA nick detection by DdrC, it is necessary to determine the structure of DdrC in complex with DNA. Ongoing efforts to co-crystalize DdrC with different DNA ligands have yet to produce diffracting crystals; however, the apo-structure of DdrC hints at the location of two possible DNA binding sites. The electrostatic surface potential of the DdrC dimer reveals two large patches of partial positive charge on the surface (Figure 6A ). Even though both potential binding sites involve the same residues from opposing chains, they each have a different shape due to the asymmetry of the DdrC dimer. One possible binding site appears to be in an ‘open’ conformation, while the other is in a ‘closed’ conformation.

Prediction of DdrC-DNA complex formation. ( A ) Surface representation of the DdrC homodimer colored by domains (center) and by electrostatic surface potential (left and right). Two large surface patches of positive electrostatic potential are highlighted (°,•). The positively-charged residues corresponding to each patch are indicated on a DdrC domain map (bottom). ( B ) Computational model of DdrC bound to a DNA duplex with no internal lesions. Axes of symmetry are shown corresponding to the NTD (yellow) and the CTD (green). ( C ) Electrostatic surface of contacting residues in the CTD and ( D ) the NTD. ( E ) Conformation of the α6 helices in the DdrC-DNA complex. ( F ) Computational model of DdrC bound to two DNA duplexes with one single-strand break each. ( G ) Contacting residues in the CTD and ( H ) the NTD. ( I ) Conformation of the α6 helices in the dual-nick complex.

We used a rigid protein, flexible DNA docking algorithm to dock a single dsDNA duplex onto a DdrC dimer ( 37 ). The entire complex was then minimized in Rosetta to sample optimal protein–DNA contacts. As expected, the dsDNA duplex docked to one of the positive patches on DdrC. Of the two possible sites, the DNA docked to the ‘open’ binding site (Figure 6B ). In this binding mode, most of the protein–DNA interactions are mediated by the CTD (Figure 6C ). Residues within the flexible CTD clasp make non-sequence-specific contacts with the minor groove to the DNA duplex. The DdrC clasp is slightly deforming the duplex as it presses the DNA into the NTD, where some contacts between the NTD and the DNA backbone are made (Figure 6D ). In this conformation, the α6 helices of DdrC are still in the ‘loaded’ state, so any tension that may have been stored in the ‘loaded spring’ has not been released (Figure 6E ). Since all of the DdrC-DNA contacts in this model involve only internal DNA nucleotides, as opposed to ss- or ds-break sites, we hypothesize that this binding mode represents a state of lesion scanning. In this state, DdrC may be scanning for ss- or ds-breaks by deforming the DNA and interrogating the DNA duplex for a specific mechanical response. To fully understand the mechanism of nick detection, a structure of DdrC bound to nicked DNA is also required.

Accurate prediction of a nicked dsDNA complex is challenging to accomplish using traditional docking methods because the addition of a single nick greatly increases the structural degrees of freedom of the DNA duplex. The docking algorithm would need to cover a very large conformational space for both the DdrC dimer and the nicked duplex in order to find the correct docking pose. Recent advances in structure prediction now allow for de novo prediction of protein-nucleic acid complexes from sequence using a trained neural-net model ( 52 ). One such algorithm, RF2NA, was used to predict the structure of a DdrC dimer in complex with a nicked DNA duplex, which was then minimized using Rosetta Relax (Figure 6F ). Unlike the unbroken DNA duplex, the nicked DNA was docked to the ‘closed’ pocket of the DdrC dimer. An unbroken DNA duplex would be unable to fit in the closed pocket, but the introduction of a single nick appears to increase DNA flexibility in such a way that binding to the closed pocket becomes possible. When a nick is present, the DNA duplex lends itself to significant deformation by residues within the CTD clasp. This deformation is primarily mediated by Lys-170 on DdrC as it protrudes into the DNA duplex and disrupts base-pair contacts, while forming a π-cation interaction with the face of a DNA base (Figure 6G ). The duplex deformation by the CTD also allows for nick-specific contacts to occur within the NTD. Most notably, Arg-14 is predicted to form a π-cation interaction with the terminal DNA base on the 5′ end of the nick, while Arg-81 forms a positively charged binding pocket for DNA backbone atoms on the 3′ end of the nick, including the terminal 3′OH itself (Figure 6H ). It is of note that the terminal Phosphate group on the 5′ end is not predicted to form any polar contacts with DdrC, and so it does not appear to be important for nick detection. This feature of the model matches experimental observations, as nick-mediated DNA compaction by DdrC is unimpaired when all 5′ Phosphates are removed (Figure 2D ).

Another interesting feature of the DdrC-nicked DNA structure is the change in global symmetry. RF2NA predicts a symmetric binding conformation of DdrC, where both the binding sites are in a ‘closed’ conformation, allowing for binding to two identical nicked duplexes. In this conformation, both α6 helices in the DdrC dimer are predicted to be in the relaxed state, suggesting that the tension in α6 has been released (Figure 6I ). In order for both DdrC binding sites to be in the closed states, it is necessary for the CTD dimer interface to be disrupted. This is the prediction made by the RF2NA algorithm. Given the low number of intermolecular contacts holding the CTD dimer together, and given the low thermal stability of the CTD alone (Figure 4B ), it is clear that the CTD dimer contacts are very weak. It is therefore plausible that the CTD interface becomes broken during the nick detection process, leading to two symmetric DNA binding sites.

Together, the unbroken DNA and nicked DNA binding models hint at a possible nick detection mechanism (Figure 7A ). First, DdrC binds to unbroken DNA along the open face of the dimer, ‘scanning’ for a nick. DdrC scans for nicks by attempting to deform the duplex using energy stored in the loaded α6 helix. If a ss-break is present, the DNA will lend itself to deformation and the ‘open face’ of DdrC will adopt a closed conformation. This conformational change causes the opening of a second DNA binding site on the opposite face of the dimer that was previously closed. The newly opened binding site is now free to scan for a second nick. Once a second nick is detected, the binding site closes, trapping two DNA nicks in a conformation that is symmetric about a C2 axis of symmetry. In this conformation, the DNA duplexes are placed in a perpendicular orientation to each other, which topologically mimics a supercoiling writhe point. This duplex crossover structure would mimic a positive supercoil if both nicks are on the same DNA strand, and would mimic a negative supercoil if the nicks are on opposite strands ( Supplementary Figure S9 ). By introducing a topological writhe point for every pair of ss-breaks, DdrC progressively compacts circular DNA to a degree that is proportional with the amount of DNA damage. In other words, more ss-breaks lead to more compaction (Figure 7B ).

Proposed mechanism of DNA lesion detection and DNA topology modulation by DdrC. ( A ) Mechanism of dual nick detection. ( B ) Mechanism of ss-break-mediated DNA compaction. ( C ) Proposed binding mode of DdrC to supercoiled DNA. ( D ) Mechanism of ds-break-mediated DNA circularization. High-affinity binding events requiring a conformational change in DdrC are labeled (★).

In addition to compacting nicked DNA via supercoil-like structures, we have observed that DdrC binds directly to DNA that is already in a supercoiled state prior to binding. The band shift that occurs when DdrC interacts with supercoiled DNA is progressive, meaning that the band becomes more shifted with increasing concentrations of DdrC up to a saturation point ( Supplementary Figure S1 ). This behavior implies that there are many possible DdrC binding sites on the supercoiled plasmid that become progressively saturated. Since the affinity of the supercoiled binding event is similar to that of nicked DNA, the binding mechanisms are probably also similar. In nicked DNA, DdrC recognizes lesions through duplex deformations. We hypothesize that DdrC recognizes regions of supercoiled DNA where similar duplex deformations arise spontaneously ( Supplementary Figure S10 ). It is well understood that supercoiled DNA adopts local DNA deformations such as wrinkles, bubbles, kinks and slips to alleviate the stresses of over- or under-winding ( 50 , 52–55 ). In many of these deformations, base pair and base-stacking contacts in the DNA are disrupted, exposing unpaired bases to solvent. Since DdrC recognizes DNA nicks through DNA deformations and π interactions with exposed bases, it is possible that DdrC recognizes some specific local deformation in supercoiled DNA via the same mechanism (Figure 7C ).

Finally, we have demonstrated that DdrC circularizes DNA via direct binding to ds-breaks. A plausible structure of the ds-break complex can be generated from the nicked complex by truncating the DNA to a blunt-end at the site of the nick and minimizing the resulting model ( Supplementary Figure S11A, B ). If we follow the proposed steps of nick detection with ds-breaks instead of ss-breaks, we inevitably arrive at a mechanism for DNA circularization by DdrC (Figure 7D ). Like with the nicked DNA substrate, the CTD forms sequence-independent contacts with the duplex and pushes the ds-break into the NTD of DdrC. The NTD then makes end-specific contacts with the 5′ and 3′ terminal ends of the DNA. According to this model, a 5′ overhang would disrupt the ability of the NTD to properly engage the 3′ end of the duplex ( Supplementary Figure S11C ). So, we would expect that a 5′ overhang should reduce the affinity of DdrC to ds-breaks. This is precisely what we have observed experimentally (Figure 3A ).

Functional behavior of DdrC mutants match predictions of the computational models

In our gel-based DdrC-DNA binding assays, we can resolve two distinct binding events: one that is dependent on, and one that is independent from the presence of DNA lesions; referred to as the high-affinity (HA) and low affinity (LA) binding events, respectively ( Supplementary Figure S14 ). The HA binding event occurs at relatively low DdrC concentrations (∼10–100 nM) and requires the presence of two or more dsDNA lesions in the form of single-strand or double-strand breaks. The HA mode of binding results in a complex with a fixed stoichiometric ratio of DdrC to DNA as evidenced by a band shift to a discrete position on the gel. This DdrC-DNA species likely corresponds to the DdrC-DNA complex in Figure 6F , as this mode of binding localizes DdrC to a specific site on the DNA. On the other hand, the LA binding event, which requires higher concentrations of DdrC (>1 μM), is indicative of non-specific interactions and occurs with any form of dsDNA, irrespective of the presence of lesions or DNA topology. This binding mode leads to a substantial upward gel shift of the DNA, often preceded by a ‘smearing’ of the band. The smearing suggests that the LA mode of binding involves a variable stoichiometric ratio of DdrC to DNA, potentially involving multiple DdrC molecules per plasmid. We hypothesize that the ‘scanning’ DdrC-DNA complex shown in Figure 6B corresponds to the LA binding event on the gel, as it allows DdrC to bind at any position on the plasmid, not just at the site of damage.

By monitoring the formation of the HA and the LA species, it is possible to independently assay the lesion-specific and non-specific binding activities of DdrC. If our computational models are correct, we should be able to disrupt these two binding activities selectively through targeted mutagenesis. To disrupt non-lesion-specific interactions (corresponding to the LA species), we targeted highly conserved residues on DdrC that are predicted to directly contact DNA in both our intact and nicked DNA models. Four residues (Arg-128, Arg-142, Arg-164 and Lys-170) were identified as potential candidates for disruption, as they are predicted to be involved in ionic interactions with the DNA backbone in both scanning and nick-binding states (Figure 8A ). These interactions were disrupted by substituting all four residues with alanine (CTD-mut) or by deleting the entire C-terminal domain (ΔCTD) (Figure 8B ).

Targeted disruption of DdrC-DNA interactions. ( A ) Predicted protein–DNA interface of the HA and LA complexes at the NTD and CTD domains. Residues that were targeted for mutagenesis are highlighted and labeled. ( B ) Summary of DdrC variants harboring disruptive amino acid substitutions and deletions. ( C ) DNA binding activity of each DdrC variant measured against pUC19 plasmid in 3 different topological states: nicked, linear and supercoiled. For each DdrC/plasmid combination, 2 nM of plasmid was incubated with varying concentrations of DdrC. The relative fractions of DNA were measured as bound in either the HA, LA or unbound states. The total percentage of bound DNA is plotted here as the sum of HA and LA fractions. ( D ) Survival of different D.radiodurans R1 strains in response to varying UV-C doses. The surviving fraction was measured in triplicate as CFU counts relative to unirradiated bacteria. All D.radiodurans strains harbor a ΔuvsE genetic background as well as a Deinococcus expression plasmid with the corresponding ddrC ORF under constitutive expression from the PDR_1261 promoter.

To disrupt lesion-specific interactions (corresponding to the HA species), we targeted residues predicted to selectively interact with nicked DNA, while not interacting with un-nicked DNA. Two such residues, Arg-14 and Arg-81, were chosen. Arg-14 is predicted to interact with the face of the terminal base on the 5′ end of the nick through a π-cation interaction, while Arg-81 is part of a positively charged binding pocket for DNA backbone atoms on the 3′ end of the nick, including the terminal 3′OH itself (Figure 8A ). To disrupt these interactions, we either substituted the residues with alanine (NTD-mut) or deleted the entire N-terminal domain (ΔNTD) (Figure 8B ).

The DNA binding characteristics of the DdrC variants were assayed against both linear, nicked, and supercoiled pUC19 (Figure 8C ). Disrupting the non-specific interactions (CTD-mut and ΔCTD) led to a disruption of all DNA binding activity, both LA and HA. The binding appears to be disrupted equally across all three topological forms of pUC19 plasmid. This finding is consistent with our computational models that predict that the CTD domain harbors the ‘core’ DNA binding residues of DdrC. These residues are required for binding to any DNA ligand.

Disrupting the lesion-specific interactions by removal of the NTD domain (ΔNTD) resulted in the complete loss of the HA binding event, indicating that the NTD domain is responsible for lesion recognition. Interestingly, there was still detectable LA binding activity with the ΔNTD protein. This demonstrates that the CTD alone is sufficient for DNA binding but not for lesion detection.

Disruption of the two predicted nick-recognition residues in NTD domain (NTD-mut) resulted in the complete loss of the HA binding event in the case of nicked pUC19. Interestingly, the mutations had a milder effect on HA binding in the case of linear and supercoiled pUC19. This finding suggests that residues R14 and/or R81 specifically bind to ss-breaks over ds-breaks. This is supported by the computational model of DdrC bound to ds-breaks, where only Arg-14 participates in recognition of the ds-break, but not Arg-81 ( Supplementary Figure S11B ).

Although the lesion recognition residues are located in the NTD, the NTD alone cannot effectively stabilize the DdrC-DNA complex, as evidenced by the complete lack of HA or LA binding in the ΔCTD variant. The mechanism of lesion detection by DdrC likely requires proper positioning of the DNA duplex by the CTD for the lesion to make proper contact with the NTD.

To verify whether DNA binding and lesion recognition are important features of DdrC function in vitro , we measured the effect of disruptive ddrC mutations on UV-C resistance in live Deinococcus bacteria. In D. radiodurans R1 , a deletion of the ddrC gene only exhibits a modest 10-fold reduction in UV-C resistance ( 25 ). However, when combined with a deletion of the uvsE gene, a ddrC deletion is 50–100-fold more sensitive to UV-C radiation compared to a knockout of uvsE alone ( 25 ). To maximize the signal-to-noise ratio of measurements quantifying the phenotype of ddrC point mutations, all functional assays were conducted in D. radiodurans with a ΔuvsE genetic background. The functional status of different ddrC viariants were measured by expressing ddrC from a plasmid in ΔuvsEΔddrC D. radiodurans then assaying for its ability to restore UV-C resistance relative to a ΔuvsE baseline phenotype.

As expected, D. radiodurans ΔuvsE harboring an empty expression vector becomes more sensitive to UV-C when a ddrC deletion is introduced (Figure 8D , Table 5 , Supplementary Figure S17 ). Under our experimental conditions, we measure a 94% loss in UV-resistance at doses of 200 J/m 2 or higher. This loss in UV resistance can then be restored by complimentary expression of WT ddrC . In fact, the ddrC complement appears to be 210% more UV resistant than the ΔuvsE baseline at 200 J/m 2 . When the same complementation experiment is performed using mutants of ddrC , neither the NTD-mut or the CTD-mut variants of ddrC can restore UV resistance to a ddrC knockout strain, indicating that these mutants disrupt ddrC function. When compared to WT ddrC , the NTD- and CTD-mut variants exhibit a 99.8% and 99.7% loss of UV resistance respectively at a UV dose of 200 J/m 2 . In vitro, we observe that the NTD-mut lacks the ability to bind ss-breaks while the CTD-mut is deficient in DNA binding overall. From these observations, we can conclude that both DNA binding and lesion recognition are essential features of ddrC function.

Surviving fraction of different D.radiodurans R1 strains in response to varying UV-C doses

Interestingly, both the NTD-mut and CTD-mut strains exhibit significantly lower UV resistance compared to the ddrC knockout strain, demonstrating that the presence of DdrC protein with a DNA-binding deficiency is more detrimental to UV resistance than a deletion of the ddrC gene alone (Figure 8D , Table 5 , Supplementary Figure S17 ). When compared to an empty vector, the plasmids harboring the NTD and CTD-mutants confer in an 89% and 83% loss in UV resistance respectively at a UV dose of 200 J/m 2 . This dominant-negative phenotype suggests that DdrC may have additional functions beyond DNA binding and lesion recognition. One possible explanation for the dominant-negative phenotype is that DdrC may play a role in recruiting other factors to DNA via protein–protein interactions. Consequently, a semi-functional DdrC mutant deficient in DNA binding but proficient in protein binding might interfere with the function of other DNA repair proteins by sequestering them away from DNA.

In this study, we demonstrate that DdrC binds to duplex DNA at sites of ss- and ds-breaks. The observed binding characteristics strongly suggest that each functional unit of DdrC contains two DNA binding sites.

This finding is corroborated by our crystal structure of DdrC, as there are two large patches of positive electrostatic surface potential on the DdrC dimer, which hint at the location of two DNA binding pockets. Interestingly, the two potential binding sites are structurally different, despite involving the same residues from opposing DdrC chains. This asymmetry appears to be an evolved feature of the DdrC dimer, as it has been observed by us and others under different crystal lattices ( 26 ).

Our computational modeling experiments suggest that in this asymmetric state, one binding site is in an open conformation while the other is in a closed conformation. We propose that DdrC transiently binds to DNA duplex at arbitrary positions via the open binding site and scans the duplex for lesions. These interactions primarily involve DdrC residues from the CTD domain.

The presence of a ss- or ds-break allows the DNA to form favorable interactions with DdrC residues in the NTD, triggering a conformational change in DdrC. This change in conformation opens the second binding site on DdrC, through which the DdrC dimer can scan for and trap a second DNA break. This mechanism is supported by functional assays with DdrC variants, which harbor disruptive amino acid substitutions and deletions. The findings indicate that the CTD involves the core DNA binding residues while the NTD contains residues that interact specifically with DNA lesions. We showed that mutation of these residues disrupts UV-C resistance in vivo , thus demonstrating that both DNA binding and lesion recognition are necessary features of DdrC function.

It is possible that the conformation change required for nick detection is driven by stored tension forces in the DdrC dimer. In the asymmetric scanning state, the α6 helix connecting the NTD to the CTD is significantly deformed in one DdrC monomer, but not in the other. The straightening of this helix would result in the re-symmetrisation of the DdrC dimer. We also observed a network of ionic interactions between the NTD of one DdrC chain and the CTD of the other. This ‘clasping’ mechanism appears to be holding the DdrC dimer in an asymmetric state. The presence of such a robust salt-bridge network may be taken as evidence that the clasp mechanism evolved to counteract a strong force in the opposite direction. As such, we propose that there is potential energy stored in the deformation of the α6 helix. The presence of a ss-break may trigger the release this energy, causing a conformation change in DdrC and the trapping of a DNA nick.

This is similar to the mechanism of nick detection in human cells, where single-strand breaks are rapidly bound by the signalling factor PARP-1 ( 56 ). When bound internally on an un-nicked DNA ligand, PARP-1 exists as a loosely associated string of protein domains with high potential energy. The protein interrogates the DNA for ss-breaks through dimerization interactions between the F1and F2 domains. Only in the presence of a ss-break can the F2 domain twist the DNA in such a way to enable a stabilizing π-stacking interaction between a Phe residue on PARP-1 and the face of a nucleotide base that is exposed at the site of the nick (PDB 2N8A ( 57 )). The proper dimerization of F1 and F2 initiates a ‘structure collapse’ where the other PARP-1 domains associate with F1, F2 and the DNA surface to collapse into a low-energy state. The structure collapse results in a very high affinity interaction with the ss-break. The fully formed PARP-1 assembly then recruits DNA repair factors to the site of damage and triggers the DNA-damage response cascade.

The proposed mechanism for nick detection by DdrC is also similar to the mechanism of inter-base adduct recognition by the Rad4/XPC complex ( 58 , 59 ). Like DdrC, Rad4/XPC binds DNA in a scanning conformation and interrogates the DNA duplex for lesions by attempting to adopt a lower-energy protein–DNA conformation. In the case of Rad4/XPC, the complex scans by flipping out DNA bases. Although base flipping is possible for both damaged and undamaged DNA, the kinetic barrier of this operation is much lower for DNA at the site of an inter-base adduct like a thymine dimer.

Unlike PARP-1 and Rad4/XPC, DdrC senses and traps two DNA lesions for each structural unit of DdrC. The consequence of trapping pairs of DNA breaks effectively results in the circularization of linear DNA and the compaction of nicked DNA. Furthermore, the degree of DNA compaction increases with the degree of DNA damage. We have shown this to be the case using a series of precisely nicked and linearized plasmids. It makes sense why this observed behavior of DdrC would be useful to Deinococcus bacteria under DNA damaging conditions. Two ss-breaks on opposite strands could become ds-breaks if they are close enough in proximity. The immobilization of ss-breaks and compaction of nicked DNA by DdrC could prevent ss-breaks from becoming ds-breaks as ss-breaks accumulate across the genome. In the event of a ds-break, DdrC is able to bridge the DNA ends to prevent end diffusion. In addition, the trapping of DNA lesions allows Deinococcus to control the supercoiling state of its genome, even in the presence of ss- and ds-breaks.

The plasmid compaction behavior of DdrC has been observed previously, although the dependence of this process on ss-breaks has not yet been reported. Using TEM and AFM techniques, DdrC has been shown to directly promote plasmid compaction and circularization in vitro ( 25 , 26 ). In vivo , DdrC has been observed to co-localize with the compact nucleoid DNA structures in D. radiodurans following rapid expression in response to γ-radiation ( 25 ). These observations led to the proposal that DdrC is a novel nucleoid-associated protein (NAP) that maintains a compact nucleoid structure following extreme DNA damage ( 25 , 26 ). Our results support this claim. We propose that DdrC behaves as a lesion-specific NAP that neutralizes ss-breaks and compacts the nucleoid to a degree that is proportional with the amount of DNA damage present. This would aid other NAPs in maintaining a compact nucleoid even in the presence of DNA damage. Furthermore, we observed a dominant-negative behaviour of DdrC mutations that are deficient in DNA binding and nick-recognition, suggesting that DdrC may have other functions beyond DNA binding. It is possible that through protein-protein interactions, DdrC may be interacting with other NAPs or may be recruiting other repair factors to the sites of DNA damage.

Refined crystal structures and structure factors were deposited to the Protein Data Bank under the accessions 7UDI (DOI: 10.2210/pdb7UDI/pdb), 8U0G (DOI: 10.2210/pdb8U0G/pdb) and 8U1J (DOI: 10.2210/pdb8U1J/pdb). Raw diffraction images for the crystal structures 7UDI, 8U0G and 8U1J were deposited to Zenodo under the accession numbers 10022358, 8302395 and 8309780 respectively (DOI: 10.5281/zenodo.10022358, 10.5281/zenodo.8302395, 10.5281/zenodo.8309780). Computational structure models were deposited to ModelArchive under the accession numbers ma-nmyn0 (DOI: 10.5452/ma-nmyn0), ma-urph3 (DOI: 10.5452/ma-urph3), ma-50nj9 (DOI: 10.5452/ma-50nj9) and ma-otnza (DOI: 10.5452/ma-otnza).

Supplementary Data are available at NAR Online.

Part of the research described in this paper was performed using beamlines CMCF-ID and CMCF-BM at the Canadian Light Source, a national research facility of the University of Saskatchewan, which is supported by the Canada Foundation for Innovation (CFI), the Natural Sciences and Engineering Research Council (NSERC), the National Research Council (NRC), the Canadian Institutes of Health Research (CIHR), the Government of Saskatchewan, and the University of Saskatchewan.

Natural Sciences and Engineering Research Council of Canada [2008R00075]. Funding for open access charge: Natural Sciences and Engineering Research Council of Canada [2008R00075].

Conflict of interest statement . None declared.

Slade D. , Radman M. Oxidative stress resistance in Deinococcus radiodurans . Microbiol. Mol. Biol. Rev. 2011 ; 75 : 133 – 191 .

Google Scholar

Cox M.M. , Battista J.R. Deinococcus radiodurans - the consummate survivor . Nat. Rev. Microbiol. 2005 ; 3 : 882 – 892 .

Gaidamakova E.K. , Sharma A. , Matrosova V.Y. , Grichenko O. , Volpe R.P. , Tkavc R. , Conze I.H. , Klimenkova P. , Balygina I. , Horne W.H. et al. . Small-molecule Mn antioxidants in Caenorhabditis elegans and deinococcus radiodurans supplant MnSOD enzymes during aging and irradiation . mBio . 2022 ; 13 : e0339421 .

Daly M.J. , Gaidamakova E.K. , Matrosova V.Y. , Kiang J.G. , Fukumoto R. , Lee D.-Y. , Wehr N.B. , Viteri G.A. , Berlett B.S. , Levine R.L. Small-molecule antioxidant proteome-shields in Deinococcus radiodurans . PLoS One . 2010 ; 5 : e12570 .

Sharma A. , Gaidamakova E.K. , Grichenko O. , Matrosova V.Y. , Hoeke V. , Klimenkova P. , Conze I.H. , Volpe R.P. , Tkavc R. , Gostinčar C. et al. . Across the tree of life, radiation resistance is governed by antioxidant Mn2+, gauged by paramagnetic resonance . Proc. Natl. Acad. Sci. U.S.A. 2017 ; 114 : E9253 – E9260 .

Zahradka K. , Slade D. , Bailone A. , Sommer S. , Averbeck D. , Petranovic M. , Lindner A.B. , Radman M. Reassembly of shattered chromosomes in Deinococcus radiodurans . Nature . 2006 ; 443 : 569 – 573 .

Slade D. , Lindner A.B. , Paul G. , Radman M. Recombination and replication in DNA repair of heavily irradiated Deinococcus radiodurans . Cell . 2009 ; 136 : 1044 – 1055 .

Magerand R. , Rey P. , Blanchard L. , de Groot A. Redox signaling through zinc activates the radiation response in Deinococcus bacteria . Sci. Rep. 2021 ; 11 : 4528 .

Narasimha A. , Basu B. New insights into the activation of radiation desiccation response regulon in Deinococcus radiodurans . J. Biosci. 2021 ; 46 : 10 .

Blanchard L. , Guérin P. , Roche D. , Cruveiller S. , Pignol D. , Vallenet D. , Armengaud J. , de Groot A. Conservation and diversity of the IrrE/DdrO-controlled radiation response in radiation-resistant Deinococcus bacteria . Microbiologyopen . 2017 ; 6 : e00477 .

Eugénie N. , Zivanovic Y. , Lelandais G. , Coste G. , Bouthier de la Tour C. , Bentchikou E. , Servant P. , Confalonieri F. Characterization of the radiation desiccation response regulon of the radioresistant bacterium Deinococcus radiodurans by Integrative Genomic analyses . Cells . 2021 ; 10 : 2536 .

Tanaka M. , Earl A.M. , Howell H.A. , Park M.-J. , Eisen J.A. , Peterson S.N. , Battista J.R. Analysis of Deinococcus radiodurans 's transcriptional response to ionizing radiation and desiccation reveals novel proteins that contribute to extreme radioresistance . Genetics . 2004 ; 168 : 21 – 33 .

Hua Y. , Narumi I. , Gao G. , Tian B. , Satoh K. , Kitayama S. , Shen B. PprI: a general switch responsible for extreme radioresistance of Deinococcus radiodurans . Biochem. Biophys. Res. Commun. 2003 ; 306 : 354 – 360 .

Narumi I. , Satoh K. , Cui S. , Funayama T. , Kitayama S. , Watanabe H. PprA: a novel protein from Deinococcus radiodurans that stimulates DNA ligation . Mol. Microbiol. 2004 ; 54 : 278 – 285 .

Devigne A. , Meyer L. , de la Tour C.B. , Eugénie N. , Sommer S. , Servant P. The absence of the RecN protein suppresses the cellular defects of Deinococcus radiodurans irradiated cells devoid of the PprA protein by limiting recombinational repair of DNA lesions . DNA Repair (Amst.) . 2019 ; 73 : 144 – 154 .

Devigne A. , Guérin P. , Lisboa J. , Quevillon-Cheruel S. , Armengaud J. , Sommer S. , Bouthier de la Tour C. , Servant P. PprA protein is involved in chromosome segregation via its physical and functional interaction with DNA gyrase in irradiated deinococcus radiodurans bacteria . mSphere . 2016 ; 1 : e00036-15 .

Kota S. , Charaka V.K. , Ringgaard S. , Waldor M.K. , Misra H.S. PprA contributes to deinococcus radiodurans resistance to nalidixic acid, genome maintenance after DNA damage and interacts with deinococcal topoisomerases . PLoS One . 2014 ; 9 : e85288 .

Iyer L.M. , Koonin E.V. , Aravind L Classification and evolutionary history of the single-strand annealing proteins, RecT, Redbeta, ERF and RAD52 . Bmc Genomics [Electronic Resource] . 2002 ; 3 : 8 .

Gutsche I. , Vujičić-Žagar A. , Siebert X. , Servant P. , Vannier F. , Castaing B. , Gallet B. , Heulin T. , de Groot A. , Sommer S. et al. . Complex oligomeric structure of a truncated form of DdrA: a protein required for the extreme radiotolerance of Deinococcus . Biochim. Biophys. Acta - Proteins Proteomics . 2008 ; 1784 : 1050 – 1058 .

Harris D.R. , Ngo K.V. , Cox M.M. The stable, functional core of DdrA from Deinococcus radiodurans R1 does not restore radioresistance in vivo . J. Bacteriol. 2008 ; 190 : 6475 – 6482 .

Sugiman-Marangos S.N. , Weiss Y.M. , Junop M.S. Mechanism for accurate, protein-assisted DNA annealing by Deinococcus radiodurans DdrB . Proc. Natl. Acad. Sci. U.S.A. 2016 ; 113 : 4308 – 4313 .

Bouthier de la Tour C. , Boisnard S. , Norais C. , Toueille M. , Bentchikou E. , Vannier F. , Cox M.M. , Sommer S. , Servant P. The deinococcal DdrB protein is involved in an early step of DNA double strand break repair and in plasmid transformation through its single-strand annealing activity . DNA Repair (Amst.) . 2011 ; 10 : 1223 – 1231 .

Xu G. , Lu H. , Wang L. , Chen H. , Xu Z. , Hu Y. , Tian B. , Hua Y. DdrB stimulates single-stranded DNA annealing and facilitates RecA-independent DNA repair in Deinococcus radiodurans . DNA Repair (Amst.) . 2010 ; 9 : 805 – 812 .

de la Tour C.B. , Mathieu M. , Servant P. , Coste G. , Norais C. , Confalonieri F. Characterization of the DdrD protein from the extremely radioresistant bacterium Deinococcus radiodurans . Extremophiles . 2021 ; 25 : 343 – 355 .

Bouthier de la Tour C. , Mathieu M. , Meyer L. , Dupaigne P. , Passot F. , Servant P. , Sommer S. , Le Cam E. , Confalonieri F. In vivo and in vitro characterization of DdrC, a DNA damage response protein in Deinococcus radiodurans bacterium . PLoS One . 2017 ; 12 : e0177751 .

Banneville A.-S. , Bouthier de la Tour C. , De Bonis S. , Hognon C. , Colletier J.-P. , Teulon J.-M. , Le Roy A. , Pellequer J.-L. , Monari A. , Dehez F. et al. . Structural and functional characterization of DdrC, a novel DNA damage-induced nucleoid associated protein involved in DNA compaction . Nucleic Acids Res. 2022 ; 50 : 7680 – 7696 .

Buzon B. , Grainger R. , Huang S. , Rzadki C. , Junop M.S. Structure-specific endonuclease activity of SNM1A enables processing of a DNA interstrand crosslink . Nucleic Acids Res. 2018 ; 46 : 9057 – 9066 .

Virtanen P. , Gommers R. , Oliphant T.E. , Haberland M. , Reddy T. , Cournapeau D. , Burovski E. , Peterson P. , Weckesser W. , Bright J. et al. . SciPy 1.0: fundamental algorithms for scientific computing in Python . Nat. Methods . 2020 ; 17 : 261 – 272 .

Vonrhein C. , Flensburg C. , Keller P. , Sharff A. , Smart O. , Paciorek W. , Womack T. , Bricogne G. Data processing and analysis with the autoPROC toolbox . Acta Crystallogr. Sect. D Biol. Crystallogr. 2011 ; 67 : 293 – 302 .

Liebschner D. , Afonine P.V. , Baker M.L. , Bunkóczi G. , Chen V.B. , Croll T.I. , Hintze B. , Hung L.-W. , Jain S. , McCoy A.J. et al. . Macromolecular structure determination using X-rays, neutrons and electrons: recent developments in Phenix . Acta Crystallogr. Sect. D Struct. Biol. 2019 ; 75 : 861 – 877 .

Cowtan K. Completion of autobuilt protein models using a database of protein fragments . Acta Crystallogr. Sect. D Biol. Crystallogr. 2012 ; 68 : 328 – 335 .

Emsley P. , Lohkamp B. , Scott W.G. , Cowtan K. Features and development of Coot . Acta Crystallogr. Sect. D Biol. Crystallogr. 2010 ; 66 : 486 – 501 .

Huang P.-S. , Ban Y.-E.A. , Richter F. , Andre I. , Vernon R. , Schief W.R. , Baker D. RosettaRemodel: a generalized framework for flexible backbone protein design . PLoS One . 2011 ; 6 : e24109 .

Alford R.F. , Leaver-Fay A. , Jeliazkov J.R. , O’Meara M.J. , DiMaio F.P. , Park H. , Shapovalov M.V. , Renfrew P.D. , Mulligan V.K. , Kappel K. et al. . The Rosetta all-atom energy function for macromolecular modeling and design . J. Chem. Theory Comput. 2017 ; 13 : 3031 – 3048 .

Holm L. Dali server: structural unification of protein families . Nucleic Acids Res. 2022 ; 50 : W210 – W215 .

Jurrus E. , Engel D. , Star K. , Monson K. , Brandi J. , Felberg L.E. , Brookes D.H. , Wilson L. , Chen J. , Liles K. et al. . Improvements to the APBS biomolecular solvation software suite . Protein Sci. 2018 ; 27 : 112 – 128 .

Banitt I. , Wolfson H.J. ParaDock: a flexible non-specific DNA–rigid protein docking algorithm . Nucleic Acids Res. 2011 ; 39 : e135 – e135 .

Conway P. , Tyka M.D. , DiMaio F. , Konerding D.E. , Baker D. Relaxation of backbone bond geometry improves protein energy landscape modeling . Protein Sci. 2014 ; 23 : 47 – 55 .

Baek M. , McHugh R. , Anishchenko I. , Baker D. , DiMaio F. Accurate prediction of nucleic acid and protein-nucleic acid complexes using RoseTTAFoldNA . Nat. Methods . 2024 ; 21 : 117 – 121 .

Chen A. , Sherman M.W. , Chu C. , Gonzalez N. , Patel T. , Contreras L.M. Discovery and characterization of native deinococcus radiodurans promoters for tunable gene expression . Appl. Environ. Microbiol. 2019 ; 85 : e01356-19 .

Meima R. , Lidstrom M.E. Characterization of the minimal replicon of a cryptic deinococcus radiodurans SARK plasmid and development of versatile Escherichia coli - D. radiodurans shuttle vectors . Appl. Environ. Microbiol. 2000 ; 66 : 3856 – 3867 .

Devigne A. , Mersaoui S. , Bouthier-de-la-Tour C. , Sommer S. , Servant P. The PprA protein is required for accurate cell division of gamma-irradiated Deinococcus radiodurans bacteria . DNA Repair (Amst.) . 2013 ; 12 : 265 – 272 .

Allerston C.K. , Lee S.Y. , Newman J.A. , Schofield C.J. , McHugh P.J. , Gileadi O. The structures of the SNM1A and SNM1B/apollo nuclease domains reveal a potential basis for their distinct DNA processing activities . Nucleic Acids Res. 2015 ; 43 : 11047 – 11060 .

Adachi M. , Hirayama H. , Shimizu R. , Satoh K. , Narumi I. , Kuroki R. Interaction of double-stranded DNA with polymerized PprA protein from Deinococcus radiodurans . Protein Sci. 2014 ; 23 : 1349 – 1358 .

Adachi M. , Shimizu R. , Shibazaki C. , Satoh K. , Fujiwara S. , Arai S. , Narumi I. , Kuroki R. Extended structure of pleiotropic DNA repair-promoting protein PprA from Deinococcus radiodurans . FASEB J. 2019 ; 33 : 3647 – 3658 .

Hirsch A.K.H. , Fischer F.R. , Diederich F. Phosphate recognition in structural biology . Angew. Chem. Int. Ed. Engl. 2007 ; 46 : 338 – 352 .

Yang W. Structure and mechanism for DNA lesion recognition . Cell Res. 2008 ; 18 : 184 – 197 .

Depew D.E. , Wang J.C. Conformational fluctuations of DNA helix . Proc. Natl. Acad. Sci. U.S.A. 1975 ; 72 : 4275 – 4279 .

Pulleyblank D.E. , Shure M. , Tang D. , Vinograd J. , Vosberg H.P. Action of nicking-closing enzyme on supercoiled and nonsupercoiled closed circular DNA: formation of a Boltzmann distribution of topological isomers . Proc. Natl. Acad. Sci. U.S.A. 1975 ; 72 : 4280 – 4284 .

Irobalieva R.N. , Fogg J.M. , Catanese D.J. , Sutthibutpong T. , Chen M. , Barker A.K. , Ludtke S.J. , Harris S.A. , Schmid M.F. , Chiu W. et al. . Structural diversity of supercoiled DNA . Nat. Commun. 2015 ; 6 : 8440 .

McCauley M.J. , Williams M.C. Mechanisms of DNA binding determined in optical tweezers experiments . Biopolymers . 2007 ; 85 : 154 – 168 .

Pyne A.L.B. , Noy A. , Main K.H.S. , Velasco-Berrelleza V. , Piperakis M.M. , Mitchenall L.A. , Cugliandolo F.M. , Beton J.G. , Stevenson C.E.M. , Hoogenboom B.W. et al. . Base-pair resolution analysis of the effect of supercoiling on DNA flexibility and major groove recognition by triplex-forming oligonucleotides . Nat. Commun. 2021 ; 12 : 1053 .

Sutthibutpong T. , Matek C. , Benham C. , Slade G.G. , Noy A. , Laughton C.K. , Doye J.P. , Louis A.A. , Harris S.A Long-range correlations in the mechanics of small DNA circles under topological stress revealed by multi-scale simulation . Nucleic Acids Res. 2016 ; 44 : 9121 – 9130 .

Fogg J.M. , Judge A.K. , Stricker E. , Chan H.L. , Zechiedrich L. Supercoiling and looping promote DNA base accessibility and coordination among distant sites . Nat. Commun. 2021 ; 12 : 5683 .

Matek C. , Ouldridge T.E. , Doyle J.P.K. , Louis A.A. Plectoneme tip bubbles: Coupled denaturation and writhing in supercoiled DNA . Sci. Rep. 2015 ; 5 : 7655 .

Pandey N. , Black B.E. Rapid detection and signaling of DNA damage by PARP-1 . Trends Biochem. Sci. 2021 ; 46 : 744 – 757 .

Eustermann S. , Wu W.-F. , Langelier M.-F. , Yang J.-C. , Easton L.E. , Riccio A.A. , Pascal J.M. , Neuhaus D. Structural basis of detection and signaling of DNA single-strand breaks by Human PARP-1 . Mol. Cell . 2015 ; 60 : 742 – 754 .

Chen X. , Velmurugu Y. , Zheng G. , Park B. , Shim Y. , Kim Y. , Liu L. , Van Houten B. , He C. , Ansari A. et al. . Kinetic gating mechanism of DNA damage recognition by Rad4/XPC . Nat. Commun. 2015 ; 6 : 5849 .

Velmurugu Y. , Chen X. , Slogoff Sevilla P. , Min J.-H. , Ansari A. Twist-open mechanism of DNA damage recognition by the Rad4/XPC nucleotide excision repair complex . Proc. Natl. Acad. Sci. U.S.A. 2016 ; 113 : E2296 – E305 .

Email alerts

Citing articles via.

• Editorial Board

Affiliations

• Online ISSN 1362-4962
• Print ISSN 0305-1048
• Copyright © 2024 Oxford University Press
• About Oxford Academic
• Publish journals with us
• University press partners
• What we publish
• New features  
• Open access
• Institutional account management
• Rights and permissions
• Get help with access
• Accessibility
• Advertising
• Media enquiries
• Oxford University Press
• Oxford Languages
• University of Oxford

Oxford University Press is a department of the University of Oxford. It furthers the University's objective of excellence in research, scholarship, and education by publishing worldwide

• Copyright © 2024 Oxford University Press
• Cookie settings
• Cookie policy
• Privacy policy
• Legal notice

This Feature Is Available To Subscribers Only

Sign In or Create an Account

This PDF is available to Subscribers Only

For full access to this pdf, sign in to an existing account, or purchase an annual subscription.

Online Students

For All Online Programs

International Students

On Campus, need or have Visa

Campus Students

For All Campus Programs

What a Thesis Paper is and How to Write One

From choosing a topic and conducting research to crafting a strong argument, writing a thesis paper can be a rewarding experience.

It can also be a challenging experience. If you've never written a thesis paper before, you may not know where to start. You may not even be sure exactly what a thesis paper is. But don't worry; the right support and resources can help you navigate this writing process.

What is a Thesis Paper?

A thesis paper is a type of academic essay that you might write as a graduation requirement for certain bachelor's, master's or honors programs. Thesis papers present your own original research or analysis on a specific topic related to your field.

“In some ways, a thesis paper can look a lot like a novella,” said Shana Chartier , director of information literacy at Southern New Hampshire University (SNHU). “It’s too short to be a full-length novel, but with the standard size of 40-60 pages (for a bachelor’s) and 60-100 pages (for a master’s), it is a robust exploration of a topic, explaining one’s understanding of a topic based on personal research.”

Chartier has worked in academia for over 13 years and at SNHU for nearly eight. In her role as an instructor and director, Chartier has helped to guide students through the writing process, like editing and providing resources.

Chartier has written and published academic papers such as "Augmented Reality Gamifies the Library: A Ride Through the Technological Frontier" and "Going Beyond the One-Shot: Spiraling Information Literacy Across Four Years." Both of these academic papers required Chartier to have hands-on experience with the subject matter. Like a thesis paper, they also involved hypothesizing and doing original research to come to a conclusion.

“When writing a thesis paper, the importance of staying organized cannot be overstated,” said Chartier. “Mapping out each step of the way, making firm and soft deadlines... and having other pairs of eyes on your work to ensure academic accuracy and clean editing are crucial to writing a successful paper.”

How Do I Choose a Topic For My Thesis Paper?

What your thesis paper is for will determine some of the specific requirements and steps you might take, but the first step is usually the same: Choosing a topic.

“Choosing a topic can be daunting," said Rochelle Attari , a peer tutor at SNHU. "But if (you) stick with a subject (you're) interested in... choosing a topic is much more manageable.”

Similar to a thesis, Attari recently finished the capstone  for her bachelor’s in psychology . Her bachelor’s concentration is in forensics, and her capstone focused on the topic of using a combined therapy model for inmates who experience substance abuse issues to reduce recidivism.

“The hardest part was deciding what I wanted to focus on,” Attari said. “But once I nailed down my topic, each milestone was more straightforward.”

In her own writing experience, Attari said brainstorming was an important step when choosing her topic. She recommends writing down different ideas on a piece of paper and doing some preliminary research on what’s already been written on your topic.

By doing this exercise, you can narrow or broaden your ideas until you’ve found a topic you’re excited about. " Brainstorming is essential when writing a paper and is not a last-minute activity,” Attari said.

How Do I Structure My Thesis Paper?

Thesis papers tend to have a standard format with common sections as the building blocks.

While the structure Attari describes below will work for many theses, it’s important to double-check with your program to see if there are any specific requirements. Writing a thesis for a Master of Fine Arts, for example, might actually look more like a fiction novel.

According to Attari, a thesis paper is often structured with the following major sections:

Introduction

• Literature review
• Methods, results

Now, let’s take a closer look at what each different section should include.

Your introduction is your opportunity to present the topic of your thesis paper. In this section, you can explain why that topic is important. The introduction is also the place to include your thesis statement, which shows your stance in the paper.

Attari said that writing an introduction can be tricky, especially when you're trying to capture your reader’s attention and state your argument.

“I have found that starting with a statement of truth about a topic that pertains to an issue I am writing about typically does the trick,” Attari said. She demonstrated this advice in an example introduction she wrote for a paper on the effects of daylight in Alaska:

In the continental United States, we can always count on the sun rising and setting around the same time each day, but in Alaska, during certain times of the year, the sun rises and does not set for weeks. Research has shown that the sun provides vitamin D and is an essential part of our health, but little is known about how daylight twenty-four hours a day affects the circadian rhythm and sleep.

In the example Attari wrote, she introduces the topic and informs the reader what the paper will cover. Somewhere in her intro, she said she would also include her thesis statement, which might be:

Twenty-four hours of daylight over an extended period does not affect sleep patterns in humans and is not the cause of daytime fatigue in northern Alaska .

Literature Review

In the literature review, you'll look at what information is already out there about your topic. “This is where scholarly articles  about your topic are essential,” said Attari. “These articles will help you find the gap in research that you have identified and will also support your thesis statement."

Telling your reader what research has already been done will help them see how your research fits into the larger conversation. Most university libraries offer databases of scholarly/peer-reviewed articles that can be helpful in your search.

In the methods section of your thesis paper, you get to explain how you learned what you learned. This might include what experiment you conducted as a part of your independent research.

“For instance,” Attari said, “if you are a psychology major and have identified a gap in research on which therapies are effective for anxiety, your methods section would consist of the number of participants, the type of experiment and any other particulars you would use for that experiment.”

In this section, you'll explain the results of your study. For example, building on the psychology example Attari outlined, you might share self-reported anxiety levels for participants trying different kinds of therapies. To help you communicate your results clearly, you might include data, charts, tables or other visualizations.

The discussion section of your thesis paper is where you will analyze and interpret the results you presented in the previous section. This is where you can discuss what your findings really mean or compare them to the research you found in your literature review.

The discussion section is your chance to show why the data you collected matters and how it fits into bigger conversations in your field.

The conclusion of your thesis paper is your opportunity to sum up your argument and leave your reader thinking about why your research matters.

Attari breaks the conclusion down into simple parts. “You restate the original issue and thesis statement, explain the experiment's results and discuss possible next steps for further research,” she said.

Find Your Program

Resources to help write your thesis paper.

While your thesis paper may be based on your independent research, writing it doesn’t have to be a solitary process. Asking for help and using the resources that are available to you can make the process easier.

If you're writing a thesis paper, some resources Chartier encourages you to use are:

• Citation Handbooks: An online citation guide or handbook can help you ensure your citations are correct. APA , MLA and Chicago styles have all published their own guides.
• Citation Generators: There are many citation generator tools that help you to create citations. Some — like RefWorks — even let you directly import citations from library databases as you research.
• Your Library's Website: Many academic and public libraries allow patrons to access resources like databases or FAQs. Some FAQs at the SNHU library that might be helpful in your thesis writing process include “ How do I read a scholarly article? ” or “ What is a research question and how do I develop one? ”

It can also be helpful to check out what coaching or tutoring options are available through your school. At SNHU, for example, the Academic Support Center offers writing and grammar workshops , and students can access 24/7 tutoring and 1:1 sessions with peer tutors, like Attari.

"Students can even submit their papers and receive written feedback... like revisions and editing suggestions," she said.

If you are writing a thesis paper, there are many resources available to you. It's a long paper, but with the right mindset and support, you can successfully navigate the process.

“Pace yourself,” said Chartier. “This is a marathon, not a sprint. Setting smaller goals to get to the big finish line can make the process seem less daunting, and remember to be proud of yourself and celebrate your accomplishment once you’re done. Writing a thesis is no small task, and it’s important work for the scholarly community.”

A degree can change your life. Choose your program  from 200+ SNHU degrees that can take you where you want to go.

Meg Palmer ’18 is a writer and scholar by trade who loves reading, riding her bike and singing in a barbershop quartet. She earned her bachelor’s degree in English, language and literature at Southern New Hampshire University (SNHU) and her master’s degree in writing, rhetoric and discourse at DePaul University (’20). While attending SNHU, she served as the editor-in-chief of the campus student newspaper, The Penmen Press, where she deepened her passion for writing. Meg is an adjunct professor at Johnson and Wales University, where she teaches first year writing, honors composition, and public speaking. Connect with her on LinkedIn .

Explore more content like this article

What is the Difference Between Bachelor’s and Master’s Degrees?

Academic Referencing: How to Cite a Research Paper

What is Considered Plagiarism And How to Avoid It

About southern new hampshire university.

SNHU is a nonprofit, accredited university with a mission to make high-quality education more accessible and affordable for everyone.

Founded in 1932, and online since 1995, we’ve helped countless students reach their goals with flexible, career-focused programs . Our 300-acre campus in Manchester, NH is home to over 3,000 students, and we serve over 135,000 students online. Visit our about SNHU  page to learn more about our mission, accreditations, leadership team, national recognitions and awards.

This week: the arXiv Accessibility Forum

Help | Advanced Search

Computer Science > Artificial Intelligence

Title: guided reasoning: a non-technical introduction.

Abstract: We introduce the concept and a default implementation of Guided Reasoning. A multi-agent system is a Guided Reasoning system iff one agent (the guide) primarily interacts with other agents in order to improve reasoning quality. We describe Logikon's default implementation of Guided Reasoning in non-technical terms. This is a living document we'll gradually enrich with more detailed information and examples. Code: this https URL

Submission history

Access paper:.

• Other Formats

References & Citations

• Google Scholar
• Semantic Scholar

BibTeX formatted citation

Bibliographic and Citation Tools

Code, data and media associated with this article, recommenders and search tools.

• Institution

arXivLabs: experimental projects with community collaborators

arXivLabs is a framework that allows collaborators to develop and share new arXiv features directly on our website.

Both individuals and organizations that work with arXivLabs have embraced and accepted our values of openness, community, excellence, and user data privacy. arXiv is committed to these values and only works with partners that adhere to them.

Have an idea for a project that will add value for arXiv's community? Learn more about arXivLabs .

We Trust in Human Precision

20,000+ Professional Language Experts Ready to Help. Expertise in a variety of Niches.

API Solutions

• API Pricing
• Cost estimate
• Customer loyalty program
• Educational Discount
• Non-Profit Discount
• Green Initiative Discount1

Value-Driven Pricing

Unmatched expertise at affordable rates tailored for your needs. Our services empower you to boost your productivity.

• Special Discounts
• Enterprise transcription solutions
• Enterprise translation solutions
• Transcription/Caption API
• AI Transcription Proofreading API

Trusted by Global Leaders

GoTranscript is the chosen service for top media organizations, universities, and Fortune 50 companies.

GoTranscript

One of the Largest Online Transcription and Translation Agencies in the World. Founded in 2005.

Speaker 1: After the title page and abstract, the reader's first true interaction with your research paper is the introduction. Your introduction will establish the foundation upon which your readers approach your work, and if you use the tips we discuss in this video, these readers should be able to logically apply the rules set in your introduction to all parts of your paper, all the way through the conclusion. What exactly is the purpose of the introduction? Think about your paper as a chronological story. It will begin at point A, the introduction, and move in time towards point B, the discussion and conclusion. Since your introduction includes content about the gaps in knowledge that your study aims to fill, the results you elaborate on in your discussion section should therefore be somewhat familiar to the reader, as you have already touched upon them in the introduction section. The introduction must answer two main questions. Why was this particular study needed to fill the gaps in knowledge? And why does this particular gap need filling? Imagine our entire plane of knowledge as an incomplete puzzle. The pieces snapped together are what is established, or what is known. The missing piece is the gap in knowledge, or what is currently unknown. This is what your study will be helping to explain. So the context you provide in the introduction must first identify that there is a knowledge gap in what it is, it must explain why it needs to be filled, and then briefly summarize how this study intends to fill that gap and why. The introduction is one of the most compact parts of the research paper, since it is not very long but needs to essentially give a complete overview of the context in which your study is taking place, and your specific reasons for doing the study. Most tend to be around 10% of the total length of your paper. The introduction consists of background information about a topic being studied, the rationale for undertaking the study, or for filling the gap with this particular information, key references to preliminary work or closely related papers appearing elsewhere, a clarification of important terms, definitions, or abbreviations to be used in the paper, and a review of related studies in which you give a brief but incisive analysis of work that heavily concerns your study. It could be a very similar study or one that supports the findings of your new study. So how should you structure your introduction? As you can see in this figure, your introduction should start broadly and then narrow until it reaches your hypothesis. The first thing you want to do is state your area of research and then immediately show what is already known. This is also known as background information. Then move on to what is unknown, the problem or gap you want to resolve. Finally, you should discuss how you will resolve this problem using a clear hypothesis. In step one, you will show what is already known. Start with a strong statement that reflects your research subject area and ask questions or post statements to frame the problems your study explores. You can ask general questions here to guide your readers to the problem and show them what we already know. For instance, what do we know about breathing capability of bottlenose dolphins? Use keywords from your title, the exact language of your study that is, to zero in on the problem at hand and show the relevance of your work. Avoid stating background information that is too broad in nature. You don't need to state too many obvious facts that your readers would know. If you are writing about bottlenose dolphins, for instance, you probably don't need to explain to them that mammals breathe oxygen. At the beginning of the introduction, you should also be sure to cite all of the sources that you use for background information and support. Only provide the necessary background information. Don't focus extensively on background, but use it to set up the context for doing this study. You should also review only relevant, up-to-date primary literature that supports your explanation of our current base of knowledge. In the second part of your introduction, you should answer the question, what is the knowledge gap? Here you will highlight areas where too little information is available. Explain how and why we should fill in that gap. What does this missing information do to impede our understanding of a process or system? And you should identify what logical next steps can be developed based on existing research. By showing you have examined current data and devised a method to find new applications and make new inferences, you're showing your peers that you are aware of the direction your research is moving in, and you're showing confidence in your decision to pursue this paper study. In the last part of your introduction, you will show how your study fills in the knowledge gap. This is where you state your purpose and give a clear hypothesis or objective of the study. The hypothesis is a very short 1-2 sentence supposition or explanation of what will happen in your study. This is quite often written as an if-then format. If X and Y are present, then Z will occur. Here you should also try to answer the question, if we fill this gap, what useful information will the readers gain? Many researchers have difficulty when it comes to deciding when to write their introduction. It is important to consider the order you draft your research paper, for as you recall, everything else in the research paper must flow from the introduction. Therefore, because it is one of the most difficult sections to nail down, consider writing the introduction second to last, after the materials and methods, results, and discussion section, and just before the conclusion. This will ensure you effectively lay a groundwork for the rest of your paper, and you can use the research you have already compiled to ensure that everything in your introduction is pertinent and accurate. In addition to content and organization, writers of research papers should also be aware of grammar and style issues that directly affect the readability and strength of their printed work. Here are some guidelines for writing the introduction section. Try and write in the active voice when possible. This will shorten your sentences and enhance the impact of your information. Always strive for concise sentences. This will allow you to get in all of the necessary information in this compact introduction section. Use stronger verbs when possible. This also impacts sentence length and strength of writing. Be careful not to overuse first-person pronouns such as I and we, and always organize your thoughts from the broad to the specific, as we have seen in our model. A strong introduction will encourage readers to read your entire research paper and help get your work published in scientific journals. For more information and tips on manuscript writing and journal submissions, visit the resources page at wordvice.com.

Get the Reddit app

Have you ever wanted to learn a martial art, or to play the guitar, or how to program a computer? Have you had difficulty figuring out where to start, what path to take or just wanted some advice to get you to the next level? Well, that's what /r/IWantToLearn is all about! Tell our community what you want to learn, and let those who came before you help guide you towards success!

IWTL how to write a research paper

I'm a college student who took on the opportunity to write a research paper on Consumer behaviour but the thing is, I've never written a research paper or even any sort of article before. I'm really interested in doing an exploratory research and want to complete this research paper. I've had only read a couple of research papers earlier and have a rough idea of the format. That's it. I'm so confused atm. Where, when and how to start, what to do etc.

I've been given a deadline to submit my paper in the last week of next month. Am I too short on time to learn and complete it or is it doable?

Edit: Thanks a lot everyone. Now I have atleast got a rough idea on what to do and where to start:)

By continuing, you agree to our User Agreement and acknowledge that you understand the Privacy Policy .

Enter the 6-digit code from your authenticator app

You’ve set up two-factor authentication for this account.

Enter a 6-digit backup code

Create your username and password.

Reddit is anonymous, so your username is what you’ll go by here. Choose wisely—because once you get a name, you can’t change it.

Reset your password

Enter your email address or username and we’ll send you a link to reset your password

Check your inbox

An email with a link to reset your password was sent to the email address associated with your account

Choose a Reddit account to continue

Choose Your Test

• Search Blogs By Category
• College Admissions
• AP and IB Exams
• GPA and Coursework

113 Great Research Paper Topics

General Education

One of the hardest parts of writing a research paper can be just finding a good topic to write about. Fortunately we've done the hard work for you and have compiled a list of 113 interesting research paper topics. They've been organized into ten categories and cover a wide range of subjects so you can easily find the best topic for you.

In addition to the list of good research topics, we've included advice on what makes a good research paper topic and how you can use your topic to start writing a great paper.

What Makes a Good Research Paper Topic?

Not all research paper topics are created equal, and you want to make sure you choose a great topic before you start writing. Below are the three most important factors to consider to make sure you choose the best research paper topics.

#1: It's Something You're Interested In

A paper is always easier to write if you're interested in the topic, and you'll be more motivated to do in-depth research and write a paper that really covers the entire subject. Even if a certain research paper topic is getting a lot of buzz right now or other people seem interested in writing about it, don't feel tempted to make it your topic unless you genuinely have some sort of interest in it as well.

#2: There's Enough Information to Write a Paper

Even if you come up with the absolute best research paper topic and you're so excited to write about it, you won't be able to produce a good paper if there isn't enough research about the topic. This can happen for very specific or specialized topics, as well as topics that are too new to have enough research done on them at the moment. Easy research paper topics will always be topics with enough information to write a full-length paper.

Trying to write a research paper on a topic that doesn't have much research on it is incredibly hard, so before you decide on a topic, do a bit of preliminary searching and make sure you'll have all the information you need to write your paper.

#3: It Fits Your Teacher's Guidelines

Don't get so carried away looking at lists of research paper topics that you forget any requirements or restrictions your teacher may have put on research topic ideas. If you're writing a research paper on a health-related topic, deciding to write about the impact of rap on the music scene probably won't be allowed, but there may be some sort of leeway. For example, if you're really interested in current events but your teacher wants you to write a research paper on a history topic, you may be able to choose a topic that fits both categories, like exploring the relationship between the US and North Korea. No matter what, always get your research paper topic approved by your teacher first before you begin writing.

113 Good Research Paper Topics

Below are 113 good research topics to help you get you started on your paper. We've organized them into ten categories to make it easier to find the type of research paper topics you're looking for.

Arts/Culture

• Discuss the main differences in art from the Italian Renaissance and the Northern Renaissance .
• Analyze the impact a famous artist had on the world.
• How is sexism portrayed in different types of media (music, film, video games, etc.)? Has the amount/type of sexism changed over the years?
• How has the music of slaves brought over from Africa shaped modern American music?
• How has rap music evolved in the past decade?
• How has the portrayal of minorities in the media changed?

Current Events

• What have been the impacts of China's one child policy?
• How have the goals of feminists changed over the decades?
• How has the Trump presidency changed international relations?
• Analyze the history of the relationship between the United States and North Korea.
• What factors contributed to the current decline in the rate of unemployment?
• What have been the impacts of states which have increased their minimum wage?
• How do US immigration laws compare to immigration laws of other countries?
• How have the US's immigration laws changed in the past few years/decades?
• How has the Black Lives Matter movement affected discussions and view about racism in the US?
• What impact has the Affordable Care Act had on healthcare in the US?
• What factors contributed to the UK deciding to leave the EU (Brexit)?
• What factors contributed to China becoming an economic power?
• Discuss the history of Bitcoin or other cryptocurrencies  (some of which tokenize the S&P 500 Index on the blockchain) .
• Do students in schools that eliminate grades do better in college and their careers?
• Do students from wealthier backgrounds score higher on standardized tests?
• Do students who receive free meals at school get higher grades compared to when they weren't receiving a free meal?
• Do students who attend charter schools score higher on standardized tests than students in public schools?
• Do students learn better in same-sex classrooms?
• How does giving each student access to an iPad or laptop affect their studies?
• What are the benefits and drawbacks of the Montessori Method ?
• Do children who attend preschool do better in school later on?
• What was the impact of the No Child Left Behind act?
• How does the US education system compare to education systems in other countries?
• What impact does mandatory physical education classes have on students' health?
• Which methods are most effective at reducing bullying in schools?
• Do homeschoolers who attend college do as well as students who attended traditional schools?
• Does offering tenure increase or decrease quality of teaching?
• How does college debt affect future life choices of students?
• Should graduate students be able to form unions?

• What are different ways to lower gun-related deaths in the US?
• How and why have divorce rates changed over time?
• Is affirmative action still necessary in education and/or the workplace?
• Should physician-assisted suicide be legal?
• How has stem cell research impacted the medical field?
• How can human trafficking be reduced in the United States/world?
• Should people be able to donate organs in exchange for money?
• Which types of juvenile punishment have proven most effective at preventing future crimes?
• Has the increase in US airport security made passengers safer?
• Analyze the immigration policies of certain countries and how they are similar and different from one another.
• Several states have legalized recreational marijuana. What positive and negative impacts have they experienced as a result?
• Do tariffs increase the number of domestic jobs?
• Which prison reforms have proven most effective?
• Should governments be able to censor certain information on the internet?
• Which methods/programs have been most effective at reducing teen pregnancy?
• What are the benefits and drawbacks of the Keto diet?
• How effective are different exercise regimes for losing weight and maintaining weight loss?
• How do the healthcare plans of various countries differ from each other?
• What are the most effective ways to treat depression ?
• What are the pros and cons of genetically modified foods?
• Which methods are most effective for improving memory?
• What can be done to lower healthcare costs in the US?
• What factors contributed to the current opioid crisis?
• Analyze the history and impact of the HIV/AIDS epidemic .
• Are low-carbohydrate or low-fat diets more effective for weight loss?
• How much exercise should the average adult be getting each week?
• Which methods are most effective to get parents to vaccinate their children?
• What are the pros and cons of clean needle programs?
• How does stress affect the body?
• Discuss the history of the conflict between Israel and the Palestinians.
• What were the causes and effects of the Salem Witch Trials?
• Who was responsible for the Iran-Contra situation?
• How has New Orleans and the government's response to natural disasters changed since Hurricane Katrina?
• What events led to the fall of the Roman Empire?
• What were the impacts of British rule in India ?
• Was the atomic bombing of Hiroshima and Nagasaki necessary?
• What were the successes and failures of the women's suffrage movement in the United States?
• What were the causes of the Civil War?
• How did Abraham Lincoln's assassination impact the country and reconstruction after the Civil War?
• Which factors contributed to the colonies winning the American Revolution?
• What caused Hitler's rise to power?
• Discuss how a specific invention impacted history.
• What led to Cleopatra's fall as ruler of Egypt?
• How has Japan changed and evolved over the centuries?
• What were the causes of the Rwandan genocide ?

• Why did Martin Luther decide to split with the Catholic Church?
• Analyze the history and impact of a well-known cult (Jonestown, Manson family, etc.)
• How did the sexual abuse scandal impact how people view the Catholic Church?
• How has the Catholic church's power changed over the past decades/centuries?
• What are the causes behind the rise in atheism/ agnosticism in the United States?
• What were the influences in Siddhartha's life resulted in him becoming the Buddha?
• How has media portrayal of Islam/Muslims changed since September 11th?

Science/Environment

• How has the earth's climate changed in the past few decades?
• How has the use and elimination of DDT affected bird populations in the US?
• Analyze how the number and severity of natural disasters have increased in the past few decades.
• Analyze deforestation rates in a certain area or globally over a period of time.
• How have past oil spills changed regulations and cleanup methods?
• How has the Flint water crisis changed water regulation safety?
• What are the pros and cons of fracking?
• What impact has the Paris Climate Agreement had so far?
• What have NASA's biggest successes and failures been?
• How can we improve access to clean water around the world?
• Does ecotourism actually have a positive impact on the environment?
• Should the US rely on nuclear energy more?
• What can be done to save amphibian species currently at risk of extinction?
• What impact has climate change had on coral reefs?
• How are black holes created?
• Are teens who spend more time on social media more likely to suffer anxiety and/or depression?
• How will the loss of net neutrality affect internet users?
• Analyze the history and progress of self-driving vehicles.
• How has the use of drones changed surveillance and warfare methods?
• Has social media made people more or less connected?
• What progress has currently been made with artificial intelligence ?
• Do smartphones increase or decrease workplace productivity?
• What are the most effective ways to use technology in the classroom?
• How is Google search affecting our intelligence?
• When is the best age for a child to begin owning a smartphone?
• Has frequent texting reduced teen literacy rates?

How to Write a Great Research Paper

Even great research paper topics won't give you a great research paper if you don't hone your topic before and during the writing process. Follow these three tips to turn good research paper topics into great papers.

#1: Figure Out Your Thesis Early

Before you start writing a single word of your paper, you first need to know what your thesis will be. Your thesis is a statement that explains what you intend to prove/show in your paper. Every sentence in your research paper will relate back to your thesis, so you don't want to start writing without it!

As some examples, if you're writing a research paper on if students learn better in same-sex classrooms, your thesis might be "Research has shown that elementary-age students in same-sex classrooms score higher on standardized tests and report feeling more comfortable in the classroom."

If you're writing a paper on the causes of the Civil War, your thesis might be "While the dispute between the North and South over slavery is the most well-known cause of the Civil War, other key causes include differences in the economies of the North and South, states' rights, and territorial expansion."

#2: Back Every Statement Up With Research

Remember, this is a research paper you're writing, so you'll need to use lots of research to make your points. Every statement you give must be backed up with research, properly cited the way your teacher requested. You're allowed to include opinions of your own, but they must also be supported by the research you give.

#3: Do Your Research Before You Begin Writing

You don't want to start writing your research paper and then learn that there isn't enough research to back up the points you're making, or, even worse, that the research contradicts the points you're trying to make!

Get most of your research on your good research topics done before you begin writing. Then use the research you've collected to create a rough outline of what your paper will cover and the key points you're going to make. This will help keep your paper clear and organized, and it'll ensure you have enough research to produce a strong paper.

What's Next?

Are you also learning about dynamic equilibrium in your science class? We break this sometimes tricky concept down so it's easy to understand in our complete guide to dynamic equilibrium .

Thinking about becoming a nurse practitioner? Nurse practitioners have one of the fastest growing careers in the country, and we have all the information you need to know about what to expect from nurse practitioner school .

Want to know the fastest and easiest ways to convert between Fahrenheit and Celsius? We've got you covered! Check out our guide to the best ways to convert Celsius to Fahrenheit (or vice versa).

These recommendations are based solely on our knowledge and experience. If you purchase an item through one of our links, PrepScholar may receive a commission.

Trending Now

How to Get Into Harvard and the Ivy League

How to Get a Perfect 4.0 GPA

How to Write an Amazing College Essay

What Exactly Are Colleges Looking For?

ACT vs. SAT: Which Test Should You Take?

When should you take the SAT or ACT?

Get Your Free

Find Your Target SAT Score

Free Complete Official SAT Practice Tests

How to Get a Perfect SAT Score, by an Expert Full Scorer

Score 800 on SAT Math

Score 800 on SAT Reading and Writing

How to Improve Your Low SAT Score

Score 600 on SAT Math

Score 600 on SAT Reading and Writing

Find Your Target ACT Score

Complete Official Free ACT Practice Tests

How to Get a Perfect ACT Score, by a 36 Full Scorer

Get a 36 on ACT English

Get a 36 on ACT Math

Get a 36 on ACT Reading

Get a 36 on ACT Science

How to Improve Your Low ACT Score

Get a 24 on ACT English

Get a 24 on ACT Math

Get a 24 on ACT Reading

Get a 24 on ACT Science

Stay Informed

Get the latest articles and test prep tips!

Christine graduated from Michigan State University with degrees in Environmental Biology and Geography and received her Master's from Duke University. In high school she scored in the 99th percentile on the SAT and was named a National Merit Finalist. She has taught English and biology in several countries.

Ask a Question Below

Have any questions about this article or other topics? Ask below and we'll reply!

Have a language expert improve your writing

Check your paper for plagiarism in 10 minutes, generate your apa citations for free.

• Knowledge Base
• Using AI tools
• How to Write an Introduction Using ChatGPT | Tips & Examples

How to Write an Introduction Using ChatGPT | Tips & Examples

Published on July 17, 2023 by Koen Driessen . Revised on September 11, 2023.

A good introduction is essential to any essay or dissertation. It sets up your argument and clearly indicates the scope and content of your writing.

Your introduction should be an authentic representation of your own ideas and research. However, AI tools like ChatGPT can be effectively used during the writing process to:

• Develop an introduction outline
• Summarize text
• Paraphrase text
• Provide feedback

Instantly correct all language mistakes in your text

Upload your document to correct all your mistakes in minutes

Table of contents

Developing an introduction outline, summarizing your arguments, paraphrasing text, generating feedback, other interesting articles, frequently asked questions.

While the introduction naturally comes at the beginning of your paper, it’s often one of the last parts you write. Writing your introduction last allows you to clearly indicate the most important aspects of your research to your reader in a logical order.

You can use ChatGPT to brainstorm potential outlines for your introduction. To do this, include a brief overview of all relevant aspects of your paper, including your research question , methodology , central arguments, and essay type (e.g., argumentative , expository ). For a longer essay or dissertation , you might also mention section or chapter titles.

Rearrange or edit the output so that it accurately reflects the body of your essay .

Example: Using ChatGPT to develop an outline

• Develop an outline for an essay introduction. The essay is a 2,000 word argumentative essay on the impact of children’s cartoons on consumer behavior. The research uses both qualitative and quantitative data.
• Start with a thought-provoking statement, anecdote, or statistic related to the influence of children’s cartoons on consumer behavior.
• Introduce the topic of children’s cartoons and their popularity among young audiences.
• Highlight the prevalence of media consumption among children and the significant role that cartoons play in their lives.
• Discuss the growing influence of marketing and advertising targeted at children.
• Clearly state your main argument about the impact of children’s cartoons on consumer behavior.
• Example: “This essay argues that children’s cartoons have a substantial influence on consumer behavior, shaping children’s preferences, purchase decisions, and brand loyalty. This assertion is supported by a combination of qualitative and quantitative data.”
• Briefly describe the research conducted and the use of both qualitative and quantitative data.
• Explain the purpose of the research in examining the relationship between children’s cartoons and consumer behavior.
• Mention the sample size, research methods employed, and the sources of data (e.g., surveys, interviews, content analysis).
• Discuss the significance of understanding the impact of children’s cartoons on consumer behavior.
• Highlight the potential implications for marketers, parents, and society as a whole.
• Emphasize the need for critical examination of the messages conveyed through children’s cartoons.
• Provide a brief overview of the main points or sections that will be covered in the essay.
• Examination of the persuasive techniques employed in children’s cartoons.
• Analysis of qualitative data to understand the effects of cartoons on children’s preferences and behaviors.
• Presentation of quantitative data on the relationship between exposure to cartoons and consumer behavior.
• Discussion of the ethical considerations surrounding marketing to children.
• Conclusion on the overall impact of children’s cartoons on consumer behavior.
• Summarize how the upcoming sections will provide evidence and analysis to support your argument.
• Example: “Through a combination of qualitative and quantitative data, this essay will delve into the persuasive techniques used in children’s cartoons, examine the effects of cartoons on children’s preferences and behaviors, present quantitative evidence of the relationship between exposure to cartoons and consumer behavior, discuss the ethical concerns, and ultimately draw conclusions about the influence of children’s cartoons on consumer behavior.”

Don't submit your assignments before you do this

The academic proofreading tool has been trained on 1000s of academic texts. Making it the most accurate and reliable proofreading tool for students. Free citation check included.

Try for free

At the end of your introduction, you may give a brief overview of specific sections of your paper.

You can use ChatGPT to summarize text and condense your writing to its most important ideas. To do this, copy and paste sections of your essay into ChatGPT and prompt it to summarize the text.

However, we don’t recommend passing off AI-generated outputs as your own work. This is considered academically dishonest and may be detected using AI detectors . Instead, use ChatGPT outputs as a source of inspiration to help you clearly indicate your key objectives and findings in your own words.

Alternatively, you can use a specialized tool like Scribbr’s free text summarizer , which offers a smoother user experience.

Example: Using ChatGPT to summarize text

• Provide a one-line summary of the following paragraph: “Exposure to cartoons exerts a discernible impact on a child’s preferences, primarily through the establishment of robust associations between animated characters, branded products, and positive emotional experiences. Through repeated exposure, children develop an attachment to specific brands that influences their future buying choices. Furthermore, recent studies have established a correlation between the amount of time spent watching cartoons and children’s consumer behavior, including their demands for advertised products and their influence on family purchasing decisions.”
• Repeated exposure to cartoons influences children’s preferences, brand attachments, consumer behavior, and purchasing decisions.

When writing your introduction, you may have difficulty finding fresh ways to describe the content of your essay. You can use ChatGPT as a paraphrasing tool to rephrase text in clear language. This can help you to communicate your ideas more effectively, avoid repetition, and maintain a consistent tone.

You can also use Scribbr’s free paraphrasing tool , which is designed specifically for this purpose.

Example: Using ChatGPT to paraphrase text

• Paraphrase the following sentence: “This raises ethical concerns regarding the potential exploitation of young minds for commercial gain, highlighting the need for responsible content creation and parental guidance to mitigate the impact of children’s cartoons on consumer behavior.”
• The potential exploitation of young minds for commercial gain gives rise to ethical concerns, emphasizing the importance of responsible content creation and parental guidance to reduce the influence of children’s cartoons on consumer behavior.

Once you’ve finished writing your introduction, you can use ChatGPT to generate feedback. Paste your introduction into the tool and prompt it to provide feedback on specific aspects of your writing, such as tone, clarity, or structure.

You can also use ChatGPT to check grammar and punctuation mistakes. However, it’s not specifically designed for this purpose and may fail to detect some errors. We recommend using a more specialized tool like Scribbr’s free grammar checker . Or, for more comprehensive feedback, try Scribbr’s proofreading and editing service .

Example: Using ChatGPT to get feedback

• Provide feedback on the above text with regard to tone of voice and clarity of structure.

Furthermore, the last paragraph could be revised to provide a more concise summary of the main points that will be addressed in the essay. This would help to give the reader a clearer roadmap of what to expect in the subsequent sections.

Check for common mistakes

Use the best grammar checker available to check for common mistakes in your text.

Fix mistakes for free

If you want to know more about ChatGPT, AI tools , fallacies , and research bias , make sure to check out some of our other articles with explanations and examples.

• ChatGPT vs human editor
• ChatGPT citations
• Is ChatGPT trustworthy?
• Using ChatGPT for your studies
• Sunk cost fallacy
• Straw man fallacy
• Slippery slope fallacy
• Red herring fallacy
• Ecological fallacy
• Logical fallacy

Research bias

• Implicit bias
• Framing bias
• Cognitive bias
• Optimism bias
• Hawthorne effect
• Unconscious bias

No, it’s not a good idea to do so in general—first, because it’s normally considered plagiarism or academic dishonesty to represent someone else’s work as your own (even if that “someone” is an AI language model). Even if you cite ChatGPT , you’ll still be penalized unless this is specifically allowed by your university . Institutions may use AI detectors to enforce these rules.

Second, ChatGPT can recombine existing texts, but it cannot really generate new knowledge. And it lacks specialist knowledge of academic topics. Therefore, it is not possible to obtain original research results, and the text produced may contain factual errors.

However, you can usually still use ChatGPT for assignments in other ways, as a source of inspiration and feedback.

Yes, you can use ChatGPT to summarize text . This can help you understand complex information more easily, summarize the central argument of your own paper, or clarify your research question.

You can also use Scribbr’s free text summarizer , which is designed specifically for this purpose.

Yes, you can use ChatGPT to paraphrase text to help you express your ideas more clearly, explore different ways of phrasing your arguments, and avoid repetition.

However, it’s not specifically designed for this purpose. We recommend using a specialized tool like Scribbr’s free paraphrasing tool , which will provide a smoother user experience.

Cite this Scribbr article

If you want to cite this source, you can copy and paste the citation or click the “Cite this Scribbr article” button to automatically add the citation to our free Citation Generator.

Driessen, K. (2023, September 11). How to Write an Introduction Using ChatGPT | Tips & Examples. Scribbr. Retrieved September 3, 2024, from https://www.scribbr.com/ai-tools/chatgpt-essay-introduction/

Is this article helpful?

Koen Driessen

Other students also liked, using chatgpt for assignments | tips & examples, what can chatgpt do | suggestions & examples, how to write good chatgpt prompts, get unlimited documents corrected.

✔ Free APA citation check included ✔ Unlimited document corrections ✔ Specialized in correcting academic texts